ID: 997265169

View in Genome Browser
Species Human (GRCh38)
Location 5:132490981-132491003
Sequence GGGCGGGCCCGCGGTGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 504}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997265169_997265186 21 Left 997265169 5:132490981-132491003 CCGGGGCCACCGCGGGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 504
Right 997265186 5:132491025-132491047 TGCTCCGGCTTGCCCGGAGGAGG No data
997265169_997265177 6 Left 997265169 5:132490981-132491003 CCGGGGCCACCGCGGGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 504
Right 997265177 5:132491010-132491032 CTCCCAATCCACCCCTGCTCCGG No data
997265169_997265189 30 Left 997265169 5:132490981-132491003 CCGGGGCCACCGCGGGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 504
Right 997265189 5:132491034-132491056 TTGCCCGGAGGAGGGCTGCCCGG No data
997265169_997265181 15 Left 997265169 5:132490981-132491003 CCGGGGCCACCGCGGGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 504
Right 997265181 5:132491019-132491041 CACCCCTGCTCCGGCTTGCCCGG No data
997265169_997265187 22 Left 997265169 5:132490981-132491003 CCGGGGCCACCGCGGGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 504
Right 997265187 5:132491026-132491048 GCTCCGGCTTGCCCGGAGGAGGG No data
997265169_997265184 18 Left 997265169 5:132490981-132491003 CCGGGGCCACCGCGGGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 504
Right 997265184 5:132491022-132491044 CCCTGCTCCGGCTTGCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997265169 Original CRISPR GGGCGGGCCCGCGGTGGCCC CGG (reversed) Intergenic