ID: 997266170

View in Genome Browser
Species Human (GRCh38)
Location 5:132496503-132496525
Sequence GCAGCCGGGTCAGCAGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997266166_997266170 1 Left 997266166 5:132496479-132496501 CCTCTTGCTATAGGCCATGGGTT No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266158_997266170 11 Left 997266158 5:132496469-132496491 CCCCGCCCAGCCTCTTGCTATAG No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266161_997266170 9 Left 997266161 5:132496471-132496493 CCGCCCAGCCTCTTGCTATAGGC No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266156_997266170 18 Left 997266156 5:132496462-132496484 CCTCCTTCCCCGCCCAGCCTCTT No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266159_997266170 10 Left 997266159 5:132496470-132496492 CCCGCCCAGCCTCTTGCTATAGG No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266155_997266170 21 Left 997266155 5:132496459-132496481 CCTCCTCCTTCCCCGCCCAGCCT No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266162_997266170 6 Left 997266162 5:132496474-132496496 CCCAGCCTCTTGCTATAGGCCAT No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266157_997266170 15 Left 997266157 5:132496465-132496487 CCTTCCCCGCCCAGCCTCTTGCT No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data
997266163_997266170 5 Left 997266163 5:132496475-132496497 CCAGCCTCTTGCTATAGGCCATG No data
Right 997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997266170 Original CRISPR GCAGCCGGGTCAGCAGCTAC AGG Intergenic
No off target data available for this crispr