ID: 997273987

View in Genome Browser
Species Human (GRCh38)
Location 5:132567329-132567351
Sequence AGGGCTATATTCTTTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997273986_997273987 -10 Left 997273986 5:132567316-132567338 CCACAGATAATGCAGGGCTATAT 0: 1
1: 0
2: 1
3: 15
4: 121
Right 997273987 5:132567329-132567351 AGGGCTATATTCTTTGAGAAAGG 0: 1
1: 0
2: 0
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997273987 Original CRISPR AGGGCTATATTCTTTGAGAA AGG Intronic
904198702 1:28805141-28805163 AGAGCTGGATTCTGTGAGAAGGG - Intergenic
904460272 1:30672988-30673010 AGGACTATACCCTTTGTGAATGG + Intergenic
908236294 1:62150404-62150426 AGAGCTAAATTCATTGAGAGAGG + Intronic
909700977 1:78522523-78522545 ATGTGTATATGCTTTGAGAAAGG - Intronic
910246659 1:85145922-85145944 AGGTCTTTATTATTTGATAATGG + Intergenic
915256721 1:154637158-154637180 AGGGCTATATCCTAGGAGTAAGG + Intergenic
915850895 1:159321635-159321657 AGGGTTATATTCTCTGTGAAAGG + Intergenic
916709198 1:167387265-167387287 AGTCCTTTATTATTTGAGAATGG + Intronic
917068313 1:171122120-171122142 ATGGGTATATTCTCTAAGAAAGG + Intergenic
917983332 1:180288779-180288801 TGGGCTCTAGTCTTTAAGAATGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920031654 1:203041086-203041108 AAGGCTGTATCCTTTGAGATGGG + Intronic
920254354 1:204644371-204644393 AGGGGTCTACCCTTTGAGAAAGG - Intronic
1064780272 10:18830004-18830026 AGGGCTATGCTATTGGAGAAAGG - Intergenic
1068028750 10:51681711-51681733 AGGACTATTTTCTTTAAGTAAGG + Intronic
1068741361 10:60475752-60475774 ATGGCCAGAGTCTTTGAGAAGGG - Intronic
1069520116 10:69112276-69112298 AGGGCTCTTTTCCTGGAGAAAGG - Intergenic
1072926067 10:99618681-99618703 AGGGCCATATCCATTGAAAACGG - Intronic
1076529610 10:131135810-131135832 AGGCCTACATCCTTTCAGAAGGG - Intronic
1079718170 11:23774856-23774878 TGGGCTTCATACTTTGAGAATGG - Intergenic
1079985553 11:27196968-27196990 ATGGTGATATTCTTTGAGGAGGG + Intergenic
1082683028 11:56202080-56202102 AGGGCTTTATTTTTTTAAAAGGG - Intergenic
1087194339 11:95290133-95290155 AGGGCTCTATTCTGTCAGTATGG + Intergenic
1087707958 11:101516618-101516640 ACTGCTATATTCTTAGAGGAAGG + Intronic
1089267044 11:117271451-117271473 AGGACTATGATCATTGAGAAAGG - Intronic
1090399475 11:126439929-126439951 AGGGATAAGTTCTTTGAGGAAGG + Intronic
1091025968 11:132141652-132141674 AGGCCTATACTGTTTGAGCAGGG - Intronic
1091689248 12:2584470-2584492 AGGGTCATTTTCTTTAAGAATGG + Intronic
1092982493 12:13810541-13810563 AGGGCTTTATTATTTGTGAGTGG + Intronic
1094573951 12:31666608-31666630 AGGACTATATTCTCAGTGAAAGG - Intronic
1095443568 12:42261738-42261760 AGTGATAAATACTTTGAGAAGGG - Intronic
1095708931 12:45267784-45267806 AGTGCTATTTTTTTTGAGATGGG - Intronic
1095855549 12:46856729-46856751 AAGCCTTTATTCTTTGAGAGAGG + Intergenic
1096960959 12:55577057-55577079 GGGTTTATATACTTTGAGAAAGG + Intergenic
1100326769 12:93547351-93547373 AAGCCTTTATTCTTTGATAAAGG + Intergenic
1100838988 12:98593442-98593464 GGGTCTATATTTTTTGAGAGGGG - Intergenic
1103215487 12:119198486-119198508 AGGGGTGTCTTCTTAGAGAAGGG + Intronic
1103755069 12:123198464-123198486 TGGGCTATATTCTATTAAAATGG - Intronic
1105294989 13:19080531-19080553 AGTGCTATATTATTTGAAAGAGG + Intergenic
1106366787 13:29089418-29089440 ATGACTATGTGCTTTGAGAAAGG + Intronic
1107460310 13:40595597-40595619 AGGGGCATATTCTGTTAGAAGGG + Intronic
1108954527 13:56136324-56136346 AGGGATAGATTAGTTGAGAATGG - Intergenic
1109210360 13:59527955-59527977 AGGGCAATAGACTTTGAAAAAGG + Intergenic
1110055157 13:70959083-70959105 AGGGCTGTATTGTTTGACCAGGG - Intergenic
1111511356 13:89267987-89268009 AGGGCAATATCCTAAGAGAAAGG - Intergenic
1113331014 13:109327685-109327707 TGGGCTATCATTTTTGAGAATGG + Intergenic
1115186631 14:30696448-30696470 AGGGATAAATCGTTTGAGAAAGG - Intronic
1116318590 14:43430401-43430423 AGGGTTATATTCTTTTACACTGG - Intergenic
1116778890 14:49213751-49213773 AAGGCTATTTTCTTTGATTAAGG + Intergenic
1117979478 14:61328297-61328319 ACTGCTATATTCTTTGAATATGG + Intronic
1118683102 14:68263735-68263757 AGGCCTATGTTCTTTCATAATGG + Intronic
1126581938 15:50250110-50250132 AGGGCTAGATTCTCTGACAGCGG - Intronic
1126971328 15:54115279-54115301 TTGGGTATATGCTTTGAGAAAGG + Intronic
1127203629 15:56687799-56687821 AGGGCTATACTCTGAGAGTAAGG + Intronic
1131230744 15:90657199-90657221 ATTTCTATATTCTTGGAGAAGGG + Intergenic
1133825466 16:9274427-9274449 AGGGCTTTCTTTTATGAGAATGG + Intergenic
1137533290 16:49297917-49297939 AGGGCTATTTTATTTGAAACAGG - Intergenic
1137794795 16:51206822-51206844 AAGACTATATTCTTTTAGGATGG + Intergenic
1138051704 16:53785561-53785583 AGGCCTACATGATTTGAGAATGG + Intronic
1144730700 17:17524446-17524468 AAGGCTATAATTTTTGAAAAGGG - Intronic
1145230133 17:21167896-21167918 AGGCCTGTTTTCTTTGAAAATGG - Intronic
1148856519 17:50581911-50581933 AGGACTTTATTATTTTAGAAGGG - Intronic
1149722369 17:58859209-58859231 AGTTCTACATTCTGTGAGAAGGG + Intronic
1153623014 18:6997675-6997697 AGGGATATAGTCATTGGGAATGG - Intronic
1153818802 18:8814581-8814603 TGGCATATATTCTTTGAAAATGG + Intronic
1157226961 18:45874957-45874979 AGGACTATATTCTTACTGAAAGG + Intronic
1157671632 18:49534189-49534211 AAATCTTTATTCTTTGAGAAAGG - Intergenic
1158066296 18:53413289-53413311 AGTGCTATATTCTTGGATAGGGG - Intronic
1158683130 18:59586899-59586921 CGTTCTTTATTCTTTGAGAAGGG + Intronic
1159736304 18:72102578-72102600 CTGGCTATGTCCTTTGAGAAGGG - Intergenic
1160302943 18:77702927-77702949 AAGACTATATTGTTTGAGACTGG - Intergenic
931132907 2:59359057-59359079 AAGGCTGAATTCCTTGAGAAAGG - Intergenic
932268325 2:70387245-70387267 GGGGCTTTTTTCTTTGAGACAGG - Intergenic
933330702 2:80889873-80889895 AGGTCTATTTTCTTTCAAAAAGG - Intergenic
933571146 2:84014292-84014314 AGGTCTATATTTTCTGAGTATGG - Intergenic
937553253 2:123121378-123121400 AGTCATAAATTCTTTGAGAAGGG - Intergenic
938165919 2:129026749-129026771 AGGTCTATAATCTATGAAAACGG - Intergenic
938912058 2:135895070-135895092 AGGGCTAAATTCTAAGAGAGAGG + Intergenic
940813745 2:158275478-158275500 AGTTCTTTATTTTTTGAGAAAGG - Intronic
941361916 2:164561847-164561869 AGGGCAATACTCTGTGTGAAGGG + Intronic
943653133 2:190478645-190478667 AGGGCTATATATTGTGAGAGTGG - Intronic
945122743 2:206474579-206474601 ATTGCTATTTTCTTTGAGAATGG + Intronic
948356632 2:237383242-237383264 AGGTCTATGTTCTAAGAGAAGGG + Intronic
1170522127 20:17197532-17197554 AAGGCTCAATTCTTTGAGAGAGG - Intergenic
1170749099 20:19129462-19129484 AGGGCTGGATTCTCTGGGAAAGG + Intergenic
1174773942 20:53326140-53326162 TCGGCTTTATGCTTTGAGAATGG + Intronic
1176918653 21:14658919-14658941 AAGCCTATATTATTTGATAATGG - Intergenic
1183027047 22:35073069-35073091 AGGACTGTTTACTTTGAGAAAGG - Intronic
951296710 3:20945546-20945568 AGATCAATATTCTTTGGGAATGG - Intergenic
953571846 3:44077446-44077468 AGGGCTTTATTTATTCAGAAGGG - Intergenic
954006580 3:47596117-47596139 AGGGCTATATTAATTCAAAAAGG + Intronic
955421969 3:58747929-58747951 AGGGCTATATTGTTTTTGAAAGG + Intronic
955716598 3:61836239-61836261 AGGGCTATGTTCTATAACAAAGG - Intronic
956645135 3:71447714-71447736 AAGGCCAGATTCTTTTAGAAGGG - Intronic
957266799 3:77977396-77977418 AGGGCCACATTCTCTGAGGAAGG - Intergenic
957318781 3:78602555-78602577 AGGGTTATAATCTGTGAGACTGG - Intronic
958133223 3:89456584-89456606 AGCGGAAGATTCTTTGAGAATGG - Intronic
959281805 3:104351682-104351704 AGGCCTTCATTCTTTGAGAGAGG - Intergenic
959560177 3:107770449-107770471 AGGGCTATAGAAGTTGAGAAAGG + Intronic
962091027 3:132244520-132244542 AGGGGCATTTTCTTTTAGAAAGG - Intronic
962404276 3:135086784-135086806 AGTTTTGTATTCTTTGAGAATGG + Intronic
964047615 3:152349137-152349159 AGGGATACATTCTTAGGGAATGG - Intronic
964637890 3:158877633-158877655 AGGGTTATAGTCTTGGAGAGGGG + Intergenic
965457889 3:168926846-168926868 AGGGTTTTACTCTTTGAAAATGG + Intergenic
966785194 3:183617214-183617236 AGGGCTAAATTCCTGGAGAGAGG - Intergenic
967479175 3:189954789-189954811 AGGGCTATATCTTTCCAGAAAGG - Intergenic
967487845 3:190054938-190054960 ATGGATAGATTCTTGGAGAATGG - Intronic
968846959 4:3048835-3048857 AGGGCTTTACTCTTCCAGAAGGG - Intergenic
969076647 4:4584357-4584379 GGTGTTATATTCTTTCAGAAAGG + Intergenic
969258389 4:6018536-6018558 AGGAAAATATCCTTTGAGAAGGG + Intergenic
970002508 4:11378496-11378518 AGGGCTATTTGCATTGAGAGGGG + Intergenic
972504083 4:39704848-39704870 AGGTGTATAGTCTTTAAGAAGGG - Intronic
973035446 4:45400118-45400140 AAGCCTATATTCTTTGATAGAGG + Intergenic
973092348 4:46153645-46153667 AAGGCAAAATTATTTGAGAAAGG - Intergenic
973195932 4:47441560-47441582 AATGCTATTTTCTTTGAAAAGGG - Intergenic
973267418 4:48225041-48225063 AGGGCTATTTTATTTCTGAATGG + Intronic
975536220 4:75454169-75454191 AGGGCTGAATTATTTGAGAAGGG - Intergenic
976365147 4:84224881-84224903 AGGGCTGTATTATTTAAGTAGGG - Intergenic
976983791 4:91266833-91266855 AAGGCTATATTCTATGACTATGG + Intronic
977521353 4:98088281-98088303 AGGGCTATATTGAGTGAGATAGG - Intronic
977901985 4:102432945-102432967 TGGGCTAAATTGTTTGAAAAGGG + Intergenic
977962591 4:103102950-103102972 AAGGCTCTACTCTTTGAGATGGG + Intergenic
978573843 4:110168965-110168987 AATGTTATTTTCTTTGAGAAAGG + Intronic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
979422076 4:120516759-120516781 AGGGTTAAATTCTTTGAGACTGG - Intergenic
980330652 4:131407031-131407053 AGGGCTACATTGTTTAAGAAAGG - Intergenic
980709195 4:136542095-136542117 AGGCCTGGATTCTTGGAGAATGG - Intergenic
981172444 4:141640546-141640568 AGGGCAATATTCTTTGACATAGG - Intronic
981774149 4:148345861-148345883 TGGGCTATAACCTCTGAGAAGGG - Intronic
982155259 4:152513772-152513794 AGGGCTTTAGTGTTTCAGAATGG - Intronic
986640398 5:9866613-9866635 AGGCCTATATCCTATGAGTAAGG - Intergenic
987495932 5:18644741-18644763 AGGGCCATGTGCTTTGAGATTGG + Intergenic
987720085 5:21622355-21622377 AGGTCTGTTTGCTTTGAGAAGGG + Intergenic
989488040 5:42014757-42014779 AGGGATATAAGCTTTGAGACTGG + Intergenic
991022136 5:61990390-61990412 AGTGCTAGATTCTTTTAAAATGG - Intergenic
993683966 5:90915527-90915549 AAGGCTAAACTCTTTTAGAAAGG + Intronic
997273987 5:132567329-132567351 AGGGCTATATTCTTTGAGAAAGG + Intronic
1000047396 5:157533014-157533036 GAGGCCATATTCTTTGATAAAGG - Intronic
1000503270 5:162079586-162079608 AAGCCTATATTCTAGGAGAAGGG + Intronic
1003638006 6:7852249-7852271 AGGGCTAAACTCTAGGAGAAAGG - Intronic
1003697135 6:8420142-8420164 AGGGCCTTTTTCTTTGAGCATGG + Intronic
1004872624 6:19922604-19922626 AGGACTAGGTTCTCTGAGAAAGG + Intergenic
1008462447 6:51791180-51791202 AGAATTATATTCTGTGAGAAGGG - Intronic
1010536824 6:77040771-77040793 CAGGCTGTATTCATTGAGAAAGG - Intergenic
1010601007 6:77826504-77826526 AAGGCTGTACACTTTGAGAAGGG - Intronic
1010759011 6:79700414-79700436 GGGACTATATTTTTTGAGAAAGG + Exonic
1012223557 6:96679616-96679638 AGAGATTTATTCTCTGAGAATGG - Intergenic
1013945855 6:115721450-115721472 TGGGCAATCTTCATTGAGAATGG - Intergenic
1015176757 6:130317860-130317882 AGGCCTATATTCTCAGAGTAAGG + Intronic
1017670183 6:156763101-156763123 ATGTCTAGATGCTTTGAGAATGG - Intergenic
1017818805 6:158034173-158034195 ATGGCTATATTCTAGGGGAACGG - Intronic
1018415763 6:163600960-163600982 AGGGCTGTCTGCTTTGGGAAGGG + Intergenic
1018433766 6:163743712-163743734 AGGGCCATATTATGTGAGACAGG - Intergenic
1018841938 6:167523771-167523793 AGCGCAATATTCTTAGTGAACGG - Intergenic
1021581314 7:22156878-22156900 AGGGCTTTATTCTGTGAGATGGG + Exonic
1024663378 7:51520860-51520882 AGGGCTATGAGCTATGAGAATGG - Intergenic
1024766366 7:52665730-52665752 ATGGCTATATTTTTTAAAAATGG - Intergenic
1030585957 7:111419850-111419872 AGGACAATATTTTTTGAGTAAGG - Intronic
1033434559 7:141321304-141321326 GGGGCAATCTGCTTTGAGAAAGG - Intronic
1033452347 7:141473095-141473117 AAGGATTTATTCTATGAGAAGGG + Exonic
1035940067 8:3890008-3890030 ATGTTTATATTTTTTGAGAAGGG - Intronic
1036679320 8:10859318-10859340 AGGGCTTTATTCCTTTAAAAAGG - Intergenic
1037315800 8:17598363-17598385 AGGGGTTTATTCTTTCAGGAGGG - Intronic
1038527600 8:28289977-28289999 AGGGTTATATTCTCTGAAAATGG - Intergenic
1039389473 8:37165966-37165988 TTGGCAATATTCTTTGAGACAGG - Intergenic
1040775054 8:51032540-51032562 AGGATTATATTCTCTGAAAATGG - Intergenic
1043651661 8:82601815-82601837 AGGGCATTTTTCTTTGAAAATGG - Intergenic
1045467189 8:102481110-102481132 AGGGCTCTATGCTCTGAAAATGG - Intergenic
1046850265 8:118964326-118964348 TGCTCTATATTCTATGAGAAGGG - Intergenic
1048155614 8:131946531-131946553 ATGGCTTAATGCTTTGAGAATGG - Exonic
1052085476 9:24260387-24260409 AGGGACATATTCTTTCTGAAAGG + Intergenic
1187997370 X:24942694-24942716 AGGGCATTATTTTTTGAGATAGG + Intronic
1190625872 X:52337885-52337907 GGCGCTACATTCTCTGAGAAGGG - Intergenic
1191671614 X:63753592-63753614 AGGGGTACAATCTTTGGGAAAGG + Intronic
1191737194 X:64399341-64399363 AGGGCTGTATTCTTACAGATGGG - Intergenic
1193790461 X:85809773-85809795 AAGGCTATTTTCTTTAAAAATGG + Intergenic
1193973812 X:88092018-88092040 AAACCTTTATTCTTTGAGAAAGG + Intergenic
1194350363 X:92819273-92819295 AGGGCTTCATTCTTCTAGAAGGG - Intergenic
1194492874 X:94572773-94572795 AAGCCTTTATTCTTTGAGAGAGG + Intergenic
1194905528 X:99571778-99571800 AAACCTTTATTCTTTGAGAAAGG + Intergenic
1196008651 X:110863020-110863042 AGGGCTATAATATCTTAGAAAGG + Intergenic
1197196328 X:123704967-123704989 AGGGCTATTTTCCATTAGAAGGG + Intronic