ID: 997279117

View in Genome Browser
Species Human (GRCh38)
Location 5:132627486-132627508
Sequence CTGGGACCTGATTGATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997279117 Original CRISPR CTGGGACCTGATTGATGAGA AGG Intronic
900430041 1:2597058-2597080 CTGGGAGCTGGTGGCTGAGAGGG - Intronic
901237457 1:7675102-7675124 CTGGGACCTGGATGATGGGATGG + Intronic
901793857 1:11669073-11669095 CTGAGACCTGAAGAATGAGAAGG - Intronic
902075609 1:13782435-13782457 CTTGGACCTGAAGGATGAGGAGG - Exonic
902391707 1:16110942-16110964 CGGGGACGTGACTGAGGAGAAGG + Intergenic
902716314 1:18275387-18275409 ATGGGACGGGATTGCTGAGACGG - Intronic
903029026 1:20449404-20449426 GGGGGACCTGATTGATGAGGAGG - Intergenic
903891945 1:26575593-26575615 CTGAGATCTGAATGGTGAGAAGG + Intergenic
903934863 1:26888550-26888572 CTGAGACATGAATGGTGAGAAGG - Intronic
903948814 1:26981726-26981748 CTGAGACCTGAAAGATGAGCAGG - Intergenic
903967062 1:27097478-27097500 CTGGGACCTGAGTGTGGAGCTGG - Intergenic
903981950 1:27195139-27195161 CTGAGGCCTGAATGATGAGCAGG - Intergenic
904123756 1:28221575-28221597 TGGGGACCTGATGGATGAGAAGG - Intronic
904228258 1:29043281-29043303 CTGAGACCTGAATTATGTGAAGG + Intronic
904252436 1:29234776-29234798 CTGAGACCTGAAGTATGAGAAGG - Intergenic
904352626 1:29918860-29918882 CTGAGCCCTGATGGATGAGGAGG + Intergenic
904384711 1:30133712-30133734 CTGAGACCTAAAGGATGAGAAGG + Intergenic
904482051 1:30800285-30800307 CAGGGACCTGAGAGCTGAGAAGG + Intergenic
904898955 1:33841191-33841213 CTGGGATCTGACTGAAGGGAGGG + Intronic
904907553 1:33909324-33909346 CTGAGACCTGACTTTTGAGAAGG - Intronic
904916320 1:33973107-33973129 CTGGGATCTGGTTGAGGAGAGGG - Intronic
905172364 1:36116667-36116689 CTGGGTCCTGAAGGATGAGTCGG + Intronic
905486499 1:38301057-38301079 CTGGGTCTTGAATGATGTGAAGG + Intergenic
905490357 1:38338591-38338613 CTGGCACCTGAGTGATGAGATGG - Intergenic
905683629 1:39892828-39892850 CTGGGAGATGATTGATGACCGGG - Intergenic
905835090 1:41111789-41111811 TTGAGACCTGAATGATGAGAAGG - Intronic
906473976 1:46154842-46154864 CTGAGACCTGAATGAAGAGAAGG - Intronic
906619823 1:47267100-47267122 TAGTGACCTGAATGATGAGAAGG - Intronic
906745000 1:48215386-48215408 ATGGGAGCTGAGTGAGGAGAAGG + Intergenic
906941632 1:50260676-50260698 CAGGGAGATGATTGCTGAGAGGG + Intergenic
907077170 1:51589575-51589597 CAGAAACCTGAATGATGAGAAGG + Intronic
907669192 1:56459872-56459894 CTGAGACCTGAAGGATGAGTCGG - Intergenic
908250079 1:62258860-62258882 CTGTGACTTGAATGACGAGAAGG + Intronic
909501904 1:76344192-76344214 CTGAGAGCTGAATGATGAGAGGG + Intronic
909710179 1:78640365-78640387 CTGAAACCTGAATGAAGAGAAGG + Intronic
909782968 1:79570761-79570783 CTGAACCCTGAATGATGAGAAGG - Intergenic
910098559 1:83551929-83551951 CTGGGGGCTGACTGATGAGATGG + Intergenic
910206470 1:84753365-84753387 CTGAGACCTGAAGGATAAGAAGG - Intergenic
910532361 1:88252317-88252339 CTGAAACCTAACTGATGAGAAGG + Intergenic
910555952 1:88532888-88532910 CAGGGTCCTGCTTGATGAAATGG - Intergenic
910864454 1:91775466-91775488 CTGAGACCTGAATGGTGAAAAGG - Intronic
912337126 1:108873749-108873771 CTGGGATTTGAATTATGAGAAGG - Intronic
912557542 1:110527148-110527170 CTGGGACCTAGTTGAGGACAGGG - Intergenic
912739289 1:112178543-112178565 CTGAGATCTGATTGATGTGAAGG - Intergenic
915485108 1:156214831-156214853 CTGGAACTTGAAGGATGAGAAGG + Intronic
915632187 1:157161129-157161151 CTGGGACCTGGGTGGTCAGAAGG + Intergenic
916989131 1:170223347-170223369 CTGAGACCTGAACGATGAGAAGG - Intergenic
917322578 1:173798756-173798778 CTGAGTCCTGAATGATGAGTTGG - Intergenic
918070357 1:181129646-181129668 TTGGGACCTGATGGAAGACACGG - Intergenic
918296066 1:183158465-183158487 CTGGGCCCTGATTAATGACTAGG - Intergenic
919107698 1:193174265-193174287 CTGAGATCTGAATTATGAGAAGG - Intronic
919855547 1:201703875-201703897 CTGGGAGCTGCCTGATGAGCTGG - Intronic
920100221 1:203512725-203512747 CTGAGACCTCTGTGATGAGAAGG + Intergenic
920605731 1:207382728-207382750 CTGAGACCTGAAAGATGAGGAGG + Intergenic
920710367 1:208288835-208288857 CTGAGACCTGAAGGATGAAAAGG - Intergenic
921337709 1:214104956-214104978 TTGAGACCTGAATGATAAGAGGG - Intergenic
921876293 1:220200230-220200252 CTGAGACTTGAAGGATGAGAAGG - Intronic
921957367 1:220998533-220998555 CTGGGCCCTGTTTTATGAGCTGG - Intergenic
922249797 1:223838043-223838065 CTGAGACCTGAATGACAAGAAGG - Intronic
922290563 1:224205836-224205858 CTGAGAGCTGATTATTGAGAGGG - Intergenic
923643054 1:235785169-235785191 CTGAGACCTGAAGGAGGAGATGG - Intronic
923984276 1:239363219-239363241 CTGATACCTGAATGATAAGAAGG + Intergenic
1062955275 10:1536034-1536056 CTGGGGCCTGCTTGATGGGCCGG - Intronic
1064789360 10:18938490-18938512 CAGGAACCTGATTGATGTGTTGG + Intergenic
1065502817 10:26398730-26398752 TTGGGACCTGATGAATGAGGAGG - Intergenic
1067367797 10:45651261-45651283 TGGAGACTTGATTGATGAGAGGG - Intronic
1067527749 10:47048523-47048545 CTGGGTTCTGAAGGATGAGAAGG + Intergenic
1069947953 10:72000495-72000517 CTGAGTCCTGATTGCTTAGAAGG + Intronic
1070043549 10:72806781-72806803 GTGAAACCTGAATGATGAGAAGG + Intronic
1070163328 10:73879474-73879496 CCTGGACTTGATGGATGAGAAGG - Intergenic
1070862387 10:79683540-79683562 CTGGGACCTGTTGGACGTGAGGG - Intergenic
1070915749 10:80153601-80153623 GTGGGACCTGCCTGATGGGATGG - Exonic
1072512192 10:96139012-96139034 CTGAGACCTAAAAGATGAGAAGG + Intronic
1072736202 10:97881343-97881365 CTGAGACCTGAAGGATGAGAAGG - Intronic
1074105918 10:110389610-110389632 CTGCAACCAGAATGATGAGAAGG + Intergenic
1074545478 10:114399088-114399110 CTGGGACATGATTGGGGAGTGGG - Intronic
1075099074 10:119493277-119493299 CTGAGACCTGAAGGATGAGAAGG + Intergenic
1075287730 10:121201747-121201769 CTGAGACCTGAATGATGAGCAGG - Intergenic
1075924595 10:126240595-126240617 CTGAGACCTGAAGGCTGAGAAGG + Intronic
1075972725 10:126668356-126668378 CTTGGAGCTGATAGAAGAGAAGG + Intronic
1077514427 11:2992870-2992892 CTGGGACCTGGGGGATGAGCGGG - Intergenic
1077893133 11:6433918-6433940 CTGAGACTTCAGTGATGAGAAGG - Intronic
1078129033 11:8596658-8596680 CTGAGATCTGAATGATGAGAAGG - Intergenic
1079568016 11:21906938-21906960 CTGAGATCTGAGTGATGAGAAGG + Intergenic
1079985928 11:27200957-27200979 CTAAGACTTGAATGATGAGAGGG - Intergenic
1080403205 11:31955987-31956009 CTGAGACCTGGATGATGAGAAGG + Intronic
1080562496 11:33476711-33476733 CTGAGACCTGAATGATGAGCAGG - Intergenic
1081529814 11:43950467-43950489 CTGGGAGCTGAATGGCGAGATGG - Intergenic
1081562429 11:44230141-44230163 CAGGGACCTGACAGATGAGAAGG + Intronic
1083314992 11:61809190-61809212 CTGAGACCTGAATGATGAAAAGG - Intronic
1083985089 11:66209163-66209185 CTGAGACCTGAAAGATGAGTTGG + Intronic
1086517019 11:87624540-87624562 CTGAGACCTGAGGGCTGAGAAGG - Intergenic
1087713655 11:101583163-101583185 CTGGGACCTGAGTGAGTGGAGGG - Intronic
1089275639 11:117334002-117334024 CTGAGAACTGAATGATGAGTAGG - Intronic
1089327872 11:117669716-117669738 CTGAGACCTGAAGGATGAGATGG + Intronic
1089932053 11:122322710-122322732 CTGGGTTCTGACTGATGAGTTGG - Intergenic
1090377411 11:126301053-126301075 CTGAGACTTGAATGATGAGAAGG - Intronic
1090477659 11:127038068-127038090 CGGGGACCTCATTGATTAAAGGG + Intergenic
1091636334 12:2199716-2199738 CTGGGACCTGACAGAGGAAAAGG - Intronic
1094406659 12:30123452-30123474 TTGAGACCTGAATGATAAGAAGG + Intergenic
1094866352 12:34536050-34536072 CTGGGAGCTCATTGAGGAAATGG - Intergenic
1096318431 12:50589540-50589562 CTGAGACATGAATGAGGAGAGGG + Intronic
1097274012 12:57799172-57799194 CTGAGACCTACATGATGAGAAGG + Intronic
1097823656 12:64153101-64153123 CTAAGACCTGAATAATGAGAAGG + Exonic
1098051527 12:66458881-66458903 GTGAGACCTGAATGATGAGAAGG - Intronic
1098232583 12:68387636-68387658 CTGAAACCTGAATGATGAGGAGG - Intergenic
1099439535 12:82684605-82684627 CTAAGACCTGAATGGTGAGAAGG + Intergenic
1099648627 12:85395004-85395026 CTGAGATCTGAATGATAAGATGG + Intergenic
1100289710 12:93202103-93202125 CTGAGACCTGAGTGACAAGAAGG - Intergenic
1100388392 12:94124770-94124792 CTGAGACCTGCAGGATGAGAGGG + Intergenic
1100680123 12:96909338-96909360 CTAAGACCTGAATGATGAGAAGG + Intronic
1101009510 12:100434967-100434989 CTGAGAACTGAATGTTGAGAAGG - Intergenic
1102202842 12:111069420-111069442 CTGGGCCCTGATGGATGAACAGG - Intronic
1102300248 12:111766462-111766484 GTGAGACCTGAATGATGACAGGG - Intronic
1102426147 12:112845907-112845929 CTGAGACCAGGATGATGAGAGGG + Intronic
1102550803 12:113690768-113690790 CTGAGACCTGAAGGGTGAGATGG + Intergenic
1102744346 12:115237211-115237233 CTGAGACTTGAATTATGAGAAGG + Intergenic
1103923047 12:124409405-124409427 CTCAGACCTGAGTGATAAGAAGG - Intronic
1104147658 12:126050954-126050976 CTAATACCTGAATGATGAGAAGG - Intergenic
1104163734 12:126205936-126205958 CTGAGATCTGAATAATGAGAAGG + Intergenic
1104270493 12:127278528-127278550 CTTGGCCCTGACTGCTGAGATGG + Intergenic
1106593805 13:31120302-31120324 CTGAGACCTGAAAGATGAGTAGG + Intergenic
1107079304 13:36357224-36357246 CTGGGACCTGCTTCCTGAGGAGG + Intronic
1107946657 13:45422877-45422899 CTGAGGCCTGATGGATGAGAAGG - Intergenic
1107980219 13:45728019-45728041 CTGAGATCTGAATGAAGAGAAGG + Intergenic
1108749128 13:53429070-53429092 CAGGGACATGAGTGATAAGAAGG - Intergenic
1110911941 13:80976520-80976542 CTGGGTCCTGATGGATCAGCTGG + Intergenic
1111639748 13:90952835-90952857 CTGGTACATGAGTGAAGAGAAGG + Intergenic
1112880682 13:104102948-104102970 TTGAGACCTGAATGATGCGAAGG - Intergenic
1113767259 13:112889153-112889175 CTGGGACAGGATTGCTGGGAGGG + Intergenic
1115066169 14:29263481-29263503 CTGGATCCTTATTGATGTGATGG + Intergenic
1115448951 14:33524100-33524122 CTGAGACCTAATGGATAAGAAGG - Intronic
1115801751 14:37002100-37002122 CTGTGAACTCATTGAGGAGAAGG - Intronic
1117571554 14:57054161-57054183 CTGGGACTTGAAAGATGGGAAGG - Intergenic
1117783404 14:59257898-59257920 CTGAGACCTGATGGATAAAATGG - Intronic
1118824295 14:69366429-69366451 CTGAGACCTGAAAGATGAGAAGG - Intergenic
1120830992 14:88997067-88997089 CTGAGACCTGAATGACAAGAAGG - Intergenic
1120861796 14:89261388-89261410 CTGGGCCCAGTATGATGAGAAGG + Intronic
1125111039 15:36034541-36034563 GTGGGAGCTAAATGATGAGAAGG + Intergenic
1125554195 15:40570572-40570594 CTGGTACCTCATAGATGTGATGG - Intronic
1126108105 15:45160264-45160286 CTGAGACCTGAAAAATGAGATGG + Intronic
1126450672 15:48805007-48805029 CTGAGACTTGACTCATGAGAAGG - Intronic
1126462420 15:48927773-48927795 CTGAAACCTGAAAGATGAGAAGG - Intronic
1127766158 15:62187216-62187238 CTGGCACCTGACTGAAGAGCTGG + Intergenic
1127800931 15:62476832-62476854 ATGAGACATGATGGATGAGAAGG - Intronic
1127940146 15:63686871-63686893 TTGAGTCCTGAATGATGAGAAGG + Intronic
1129065682 15:72902039-72902061 ATGAGATCTGAGTGATGAGATGG - Intergenic
1129248569 15:74295452-74295474 CTGAGACTTGAATGATAAGAAGG + Intronic
1129411043 15:75350458-75350480 CTGAGGCCTGACTGATGAGAAGG + Intronic
1129854297 15:78812498-78812520 CTGAGACCTGATGGCTGAGGTGG - Intronic
1132466361 16:79061-79083 TTGGGACCTGCATGATGAGTGGG + Intronic
1133933968 16:10254108-10254130 CTGAGACCTGAAGGATGGGAAGG - Intergenic
1134362980 16:13550056-13550078 CTGAGAACTCAATGATGAGAAGG + Intergenic
1136400778 16:30016960-30016982 CTGAGACCTGAAAGATGAGGAGG + Intronic
1137545882 16:49403080-49403102 TTGGCACCTGAAAGATGAGAAGG + Intergenic
1138290121 16:55839695-55839717 TTGGAACCTGATTGGTGGGATGG - Intergenic
1138446410 16:57066926-57066948 CTGAGACCTGAGGGATGAGGAGG - Intronic
1138529211 16:57625936-57625958 CTGGGACCTGAAGGAGAAGAAGG - Intronic
1139841013 16:69880545-69880567 GTGTTACCTGATTGATGGGAAGG - Intronic
1140031383 16:71341957-71341979 CTGAGACCTGAGTGAGGGGAGGG + Intergenic
1140144774 16:72295898-72295920 GGGGGCCCTGAATGATGAGAAGG - Intergenic
1140484391 16:75282329-75282351 CAGGGTCCTGAGTCATGAGAAGG - Intergenic
1140901451 16:79371672-79371694 CTGAGGCCTGAATGATGAGGAGG - Intergenic
1143606182 17:7987633-7987655 CTGGGAGCTGATGGAGAAGAGGG - Intergenic
1143754326 17:9055507-9055529 CTGAGACCTGAATGAGGAGAAGG + Intronic
1143777492 17:9209064-9209086 CTGTGTCCTGAAGGATGAGAAGG - Intronic
1143830487 17:9646540-9646562 TTGAGATCTGAATGATGAGAAGG + Intronic
1144219995 17:13091201-13091223 CTGAGACCTGAAAGAGGAGAAGG + Intergenic
1144319517 17:14100511-14100533 ATGGGATCTGAAGGATGAGAAGG + Intronic
1144823187 17:18089705-18089727 CTAAGACCTGATTGAAAAGAAGG + Intronic
1144835133 17:18152837-18152859 CTGTGACATGAATGGTGAGAAGG - Intronic
1146095076 17:29922071-29922093 CTGAGACCTGAAGGATGAGTAGG + Intronic
1147252244 17:39159900-39159922 CTGAGACCTGAGTGAAGAGTAGG - Intronic
1147688943 17:42303841-42303863 CTGAGACCTGAAGGAGGAGAAGG + Intronic
1148259011 17:46162967-46162989 CTGAGACCTGAAGGATAAGAAGG - Intronic
1151277966 17:73050230-73050252 CTGAGCCCTGAATGGTGAGAAGG + Intronic
1151967565 17:77439406-77439428 CTGGGGCCTGAGAGAAGAGATGG + Intronic
1155626098 18:27836178-27836200 TTGAGACCTGAATGATAAGAAGG - Intergenic
1155743853 18:29325120-29325142 ATGGGACCTGTAGGATGAGAAGG - Intergenic
1156202732 18:34852773-34852795 CTGAGACCCCAGTGATGAGAAGG - Intronic
1157290264 18:46405089-46405111 CTAGGACCTGATTCATAAAATGG + Intronic
1157489712 18:48114164-48114186 CTGGGAACTGATGGATGGGTGGG + Intronic
1157847319 18:51016064-51016086 CTGGGGCCTGTCAGATGAGACGG - Intronic
1157962006 18:52165035-52165057 CTGGGACCTGATTGCAGAACAGG + Intergenic
1158520755 18:58170236-58170258 CTGGGCCCTGACAGATGAGAGGG - Intronic
1160008170 18:75083744-75083766 CTGAGACTTGAATGATGAGAAGG - Intergenic
1161493760 19:4576476-4576498 CTGAGACCTGGAAGATGAGAAGG - Intergenic
1161634191 19:5377031-5377053 ATGAGACCTGAATGATCAGAAGG + Intergenic
1161780794 19:6290617-6290639 CTAAGTCCTGATTGAGGAGAGGG + Intergenic
1162596128 19:11630608-11630630 CTGGGCCCTGAGTGATCAGCAGG + Intergenic
1162859356 19:13494353-13494375 CTGAGACCTAAATGAAGAGAAGG + Intronic
1163083124 19:14957827-14957849 CTGAGACTTGCATGATGAGAAGG + Intronic
1163232506 19:16014030-16014052 TTGGGACCTGGTTGATTGGAGGG + Intergenic
1164907821 19:31981912-31981934 CTGGGTCCTGATCCATAAGAGGG + Intergenic
1165929622 19:39348395-39348417 CCCAGATCTGATTGATGAGAAGG + Intronic
1166459641 19:42974933-42974955 CTGGAACATGCTTGAAGAGAGGG + Intronic
1167340600 19:48913618-48913640 CTAGGACCTGAATGCTAAGAGGG + Intronic
1167649589 19:50722137-50722159 CTGAGACCTCGATGATGAGAAGG + Intergenic
925621529 2:5798253-5798275 CAGGGATCTGATTCAGGAGAAGG - Intergenic
925660394 2:6196322-6196344 CTGGGACCTGCATGCTGAGAAGG + Intergenic
925678753 2:6394699-6394721 TTGGGACATAATTGATGAGTGGG - Intergenic
926599632 2:14828340-14828362 CTGACACCTGGGTGATGAGAGGG + Intergenic
926739992 2:16102917-16102939 CTGGGATCTGATCAATGAGCTGG - Intergenic
927200837 2:20577242-20577264 CTGGGAGCTGAGTGGGGAGAGGG + Intronic
931262918 2:60635947-60635969 CTGGGACCTGATTTATAGAAAGG + Intergenic
932705233 2:74019622-74019644 GTGGCATCAGATTGATGAGAGGG + Intronic
935596793 2:104884965-104884987 CTGAGACCTGTTTGGTGGGACGG + Intergenic
935899462 2:107775286-107775308 TTGGGACCTGAAAGATGAGAAGG + Intergenic
936286702 2:111186786-111186808 CTGGGCCCTAATGGATGAGTAGG - Intergenic
936608825 2:113981847-113981869 CTGAGTCCTGAGTGAGGAGACGG - Intergenic
937046448 2:118854568-118854590 CTGAGCCCTGATTGAGGGGAGGG + Intergenic
937078791 2:119125791-119125813 CTGGGAACTGAGGGAGGAGAAGG + Intergenic
937369239 2:121286139-121286161 CTGAGACCTGATGGATGCAAAGG + Intergenic
938703552 2:133900229-133900251 CCTAGACCTGATTGATGAGAAGG - Intergenic
939522520 2:143248248-143248270 CTGGGAACTGAAGGATAAGAAGG + Intronic
939718902 2:145622462-145622484 CTGAGATCTGACTGATGAGTAGG + Intergenic
939885501 2:147677039-147677061 TTGGGACCTGACTGCTGAAAAGG + Intergenic
940610545 2:155985734-155985756 CTGAAACCTGAATGATGGGAAGG + Intergenic
941128045 2:161610704-161610726 TTGAGACCTGAGTGGTGAGAAGG + Intronic
941760825 2:169241123-169241145 CGGGGATATGAGTGATGAGAAGG - Exonic
941978118 2:171427621-171427643 CTGAGCCCTGAATGATGAGGAGG - Intronic
942043759 2:172087303-172087325 CTGGGACTTGAGAGGTGAGAGGG - Intronic
943796745 2:192006033-192006055 CTGAGACCTGAGTAATGACATGG - Intronic
945987461 2:216366631-216366653 CTGACACCTAAATGATGAGAAGG - Intronic
946352489 2:219164410-219164432 CTGGGATCCAAATGATGAGAAGG - Intronic
946395131 2:219439860-219439882 TGGGGAGCTGAGTGATGAGAGGG - Intronic
947364294 2:229378346-229378368 CTGAGACCTGAATGAGAAGAAGG + Intronic
947840549 2:233204879-233204901 CTGGGAACTGCTCCATGAGAAGG + Intronic
948610349 2:239162579-239162601 CTGGGACCTGAGAGAGGAGGTGG - Intronic
1168841724 20:914057-914079 CTGGGACCTGAGAGATTGGAAGG + Intronic
1169290163 20:4342835-4342857 GTGGGATATGATTGATGAGTAGG - Intergenic
1169968906 20:11247642-11247664 CGGGCAGCTGATTGTTGAGAAGG - Intergenic
1170402802 20:16005953-16005975 CTGAGATATGCTTGATGAGATGG - Intronic
1172080708 20:32338541-32338563 CTGGTTCCTGATGGATGAGAAGG - Intergenic
1172185822 20:33030520-33030542 CTGAGACCTGAGGGATGAAAAGG - Intergenic
1172239672 20:33404275-33404297 CTGAGACCTAAAGGATGAGAAGG - Intergenic
1172291707 20:33781546-33781568 CTGGAATGTGATGGATGAGATGG - Intronic
1172618401 20:36305276-36305298 CTGGGCCTTGATGGATGAGTAGG + Intergenic
1172749988 20:37244048-37244070 CTGAGACCTGAAGAATGAGAAGG + Intergenic
1173029094 20:39338131-39338153 CTGAGACCTGAAGCATGAGAAGG - Intergenic
1173140475 20:40477410-40477432 CAGAGACCTGATTGAAGTGAAGG - Intergenic
1173207857 20:41008510-41008532 CTGAGACCTGAAAGATGAGAAGG - Intergenic
1173426096 20:42944681-42944703 CTGAGACCTGGTGGAAGAGAAGG - Intronic
1173538614 20:43834541-43834563 CTGAGACCTAAAGGATGAGAAGG - Intergenic
1173597499 20:44268652-44268674 GTGAGACCTGAAGGATGAGAAGG + Intronic
1173821067 20:46021162-46021184 CTGAGACCTCACTGATGAGAAGG - Intergenic
1174039844 20:47691368-47691390 TTGAGACCTGAATGATGAGAAGG + Intronic
1174182257 20:48682249-48682271 CTGAGACCTGAAGGATGAGAAGG - Intronic
1174362522 20:50037877-50037899 CTGAGACCTGAAGGAAGAGAAGG - Intergenic
1175129853 20:56780938-56780960 CTGGGACCTCATTCAAAAGAAGG - Intergenic
1175573029 20:60038503-60038525 CTGGCACCTGAAGGCTGAGAAGG - Intergenic
1175821725 20:61913627-61913649 CCGGGAACTGATTCCTGAGATGG + Intronic
1176064227 20:63186566-63186588 TTGGGACCTGAAGGATGAGTTGG - Intergenic
1176770442 21:13067250-13067272 CTGTGAGGTGATTGATGAAAAGG - Intergenic
1176912725 21:14586739-14586761 CTGAGGCCTGAATGATGAGAAGG + Intergenic
1178032798 21:28546881-28546903 CTGGGACCTTCTGGATGAGTTGG - Intergenic
1180159571 21:45992997-45993019 CTGGGACCTGTTTCATGTGAAGG + Intronic
1181185862 22:21103165-21103187 CTGGGCCCTGAGTGCTGAGGAGG + Intergenic
1181689675 22:24551626-24551648 CTGGGACCTGAATGACTAGAAGG - Intronic
1181818668 22:25458988-25459010 CTGGAACCTCTTTGATCAGAAGG + Intergenic
1182668300 22:31974818-31974840 TGGAGACCTGAATGATGAGAAGG + Intergenic
1183700394 22:39447949-39447971 CTGTGACCTGGGTGAGGAGAGGG - Intergenic
1184034801 22:41913325-41913347 CTGGGACCGGGTGGATGAGGAGG + Intronic
949164545 3:922638-922660 CTGAAACCTGATTGATGAGAAGG - Intergenic
949995897 3:9616992-9617014 CTGAAACCTGAATGAGGAGAAGG - Intergenic
950284281 3:11732701-11732723 CTGAGGCCTGAATGATGACAAGG + Intergenic
950446867 3:13043499-13043521 GTGGGACCTGACTGACGAGGAGG - Intronic
950874432 3:16257266-16257288 CTAAGACCTGAAGGATGAGAAGG - Intergenic
951535259 3:23734670-23734692 CCTGGACCTGAATGTTGAGAAGG + Intergenic
952058657 3:29480412-29480434 CTGGAACATGATGGAAGAGAAGG + Intronic
952219813 3:31313681-31313703 CTGAGACCTGATCGAAGAGTTGG - Intergenic
952403635 3:32986177-32986199 CTGAGACCTGAACGATGAGCAGG - Intergenic
953999584 3:47545124-47545146 CAGGGATCTGAATGATGGGAAGG + Intergenic
955617970 3:60828958-60828980 CTGAGACCTGAAGGATGAGAAGG + Intronic
955837440 3:63072024-63072046 CTGGGACCTGAAGGATGAGTTGG + Intergenic
955920748 3:63953275-63953297 CTGAGTCCTAAGTGATGAGAAGG + Intronic
956140729 3:66144143-66144165 CTGAGACCTGAATGATAACAAGG + Intronic
956225888 3:66957611-66957633 CTGAGACCTAGTTGATCAGAAGG - Intergenic
956414221 3:69010732-69010754 CTGAGATCTGAATGATGAGGAGG + Intronic
957718752 3:83967944-83967966 ATGGGACCTTATTAATAAGAAGG + Intergenic
958122712 3:89312791-89312813 GTGGGAGCTGAATGATGAGAAGG - Intronic
959251715 3:103956607-103956629 CTGTGACCTTTATGATGAGACGG - Intergenic
959301776 3:104611529-104611551 CTGAGACCTGAATAATAAGAAGG - Intergenic
960438350 3:117655520-117655542 CTGAGATCTGATGGATGAGCAGG + Intergenic
961363060 3:126380219-126380241 CAGGGACCTGAAGGAGGAGAGGG - Intergenic
962049056 3:131793727-131793749 CGGAGACCTGGGTGATGAGAAGG - Intronic
962965842 3:140353635-140353657 CTAGGACCTCATTGGTGTGATGG - Intronic
962975201 3:140440156-140440178 GTGGGACCTGGATGAAGAGAAGG + Intronic
963925211 3:150944109-150944131 CTGACACCTGAATGTTGAGAAGG + Intronic
964110735 3:153084677-153084699 CTGGGATCTGGGTGATGAGGGGG + Intergenic
965192073 3:165544447-165544469 CTGGCTGCTGATTGATTAGATGG - Intergenic
965955616 3:174365348-174365370 CTGAGACCTGAATGATGAGAAGG + Intergenic
966123662 3:176550231-176550253 CTGAGACCTGAAGGATGAGTAGG - Intergenic
966129423 3:176620548-176620570 CAGGGACGTGATGGAGGAGAAGG - Intergenic
968593082 4:1469345-1469367 CTGGCCCCTGTTTGATGACATGG + Intergenic
969328901 4:6461561-6461583 ATGGGAGCTGACAGATGAGAAGG + Intronic
971989674 4:33875945-33875967 ATGGGAGCTAAGTGATGAGAGGG - Intergenic
972275634 4:37555035-37555057 CTGGGATCTAAAAGATGAGATGG - Intronic
972917764 4:43902345-43902367 CTGGAACCTGATTGTAGACACGG + Intergenic
973095837 4:46198200-46198222 CTAAGAACTGAATGATGAGAAGG - Intergenic
975853983 4:78602998-78603020 CTGAAACCTGAAAGATGAGAAGG - Intronic
977086764 4:92609539-92609561 CAGAGACCTGAATGATGAAAGGG + Intronic
978636360 4:110811812-110811834 CTGAGACCTGAAGGATGAGAAGG - Intergenic
978900506 4:113943709-113943731 CTGACACCTGAGTAATGAGATGG + Intronic
980475891 4:133315804-133315826 CTTGAACATGATTGAGGAGAGGG + Intergenic
983955849 4:173698120-173698142 CTGAAACCTGAAGGATGAGAGGG + Intergenic
985144620 4:186882254-186882276 CAGGGTCCTGATAGATGAGCTGG + Intergenic
987754573 5:22084265-22084287 CTGGGGTCCGATAGATGAGATGG + Intronic
990727145 5:58768596-58768618 CAGAGACCTGAATGATGAGAAGG + Intronic
992015390 5:72570006-72570028 CTGAGACCTGAATGGTGAGTAGG - Intergenic
992407318 5:76472108-76472130 CTGGCACCTGGTTGAGGGGAAGG + Intronic
994681009 5:102887852-102887874 CTGAGATCTGAAAGATGAGAAGG - Intronic
995753636 5:115478719-115478741 CTGGGACCTGAGTGAGAACAGGG - Intergenic
996422691 5:123279479-123279501 CAGGGACCTGACTGAGGGGATGG - Intergenic
996765699 5:127031947-127031969 CTGGGACCTGAATGAGGCAATGG - Intergenic
996785394 5:127231439-127231461 CAGAGACCTGATGGATGGGAAGG - Intergenic
997214132 5:132096436-132096458 CTGAGACCTGACTGACAAGAAGG + Intergenic
997279117 5:132627486-132627508 CTGGGACCTGATTGATGAGAAGG + Intronic
997481430 5:134187867-134187889 CTGAGACCTAAAGGATGAGAAGG - Intronic
998011802 5:138701380-138701402 CTGAGGCCTGAATGATAAGAAGG + Intronic
998900965 5:146853857-146853879 CTGAGACCTGAAGGATGAGGAGG - Intronic
999112480 5:149134180-149134202 CTGAGACCTGAATGATGAGAAGG + Intergenic
999204961 5:149841232-149841254 CTGGGCCCTGATTGATGAAAAGG + Intronic
999473230 5:151874755-151874777 CTGAGACCTGAAGGGTGAGAAGG + Intronic
999562481 5:152819821-152819843 CTGTGCCCTGAATGATGACATGG + Intergenic
999665077 5:153904445-153904467 CTGGGAGCTGACTGGGGAGATGG + Intergenic
999695494 5:154185363-154185385 CTGGGACCTGAAGGATGAAAGGG + Intronic
999717148 5:154370468-154370490 CTGGGATCTGAAGGATGAGCAGG + Intronic
999762284 5:154711875-154711897 CTGAGACATGAATGATGACAAGG - Intergenic
1000241101 5:159408951-159408973 CTGAGACCTGAATGAAGAGAAGG + Intergenic
1000516660 5:162243822-162243844 CTGAGACCTGAATGACGAGAAGG - Intergenic
1000601932 5:163285360-163285382 CTGAGACCTGACTGACCAGAAGG + Intergenic
1001203071 5:169737152-169737174 CTGTGACCTGAATGATGAGTAGG + Intronic
1001219256 5:169885060-169885082 CTGGGACTTGACTGATGAACAGG - Intronic
1001561627 5:172673466-172673488 GTGGGACCTGATTGTGGTGAGGG - Intronic
1001573311 5:172744897-172744919 CTGGGCCCTGAAGGATGAGTAGG - Intergenic
1001829936 5:174777488-174777510 CTGAGACTTGAGTGATGGGAAGG + Intergenic
1002059365 5:176617259-176617281 CTGAAACCTGATGGAGGAGAGGG - Intergenic
1002089260 5:176794762-176794784 CTGAGACCTGAGTGATGAGAAGG - Intergenic
1002123002 5:177020294-177020316 CTAAGACCTGATTAATGAGAAGG - Intronic
1002139633 5:177131401-177131423 CTGGAACGGGACTGATGAGAGGG - Intergenic
1002301376 5:178259240-178259262 CTGAGACCTGAATGAGGTGAAGG + Intronic
1003449850 6:6220358-6220380 CAGGGACCTGAATGAGGACAGGG + Intronic
1006094709 6:31648806-31648828 CTGGGACCTGATTTAGTAGGTGG - Intronic
1006172886 6:32105233-32105255 CTGAGACCTGAAGGATGAGAAGG - Intronic
1007290825 6:40785344-40785366 CTGGAACCTGAATGACGAGCAGG - Intergenic
1008636276 6:53413978-53414000 TTGAGACCTGAATGATGAGATGG - Intergenic
1009847849 6:69156365-69156387 CTGATATCTGAATGATGAGAAGG + Intronic
1010328536 6:74593762-74593784 CTGAGACCTGAATAATGAGAAGG - Intergenic
1011744434 6:90396088-90396110 CTGAGACCTGAAGGATGAGTAGG - Intergenic
1013299728 6:108793582-108793604 ATGGGACATGACTAATGAGAAGG - Intergenic
1014467428 6:121773362-121773384 CAGGGACCTGATTGTTGGAAGGG + Intergenic
1015057795 6:128924770-128924792 TTGCAACATGATTGATGAGAAGG - Intronic
1016346076 6:143115853-143115875 CTGTGTCCTGAATGAGGAGAGGG + Intronic
1016944005 6:149511159-149511181 CTGGGCCCTGGTGGATGAGAAGG - Intronic
1017304251 6:152898428-152898450 CTGGGATCTTGCTGATGAGAGGG - Intergenic
1017572044 6:155756081-155756103 CTTGTACTTGGTTGATGAGAAGG - Intergenic
1018825569 6:167405914-167405936 CTGAGACCAGAAGGATGAGAGGG + Intergenic
1019559168 7:1647510-1647532 CTGCCACCTGACTGATGAGAAGG + Intergenic
1021838046 7:24700009-24700031 CTGACAACTGAGTGATGAGAAGG - Intronic
1022338763 7:29448727-29448749 CTGAGACCTTAAGGATGAGAAGG - Intronic
1023257996 7:38330876-38330898 GTGGGACCTGAGTTTTGAGAGGG - Intergenic
1023764379 7:43497171-43497193 CTGAAACCTGAAGGATGAGAAGG + Intronic
1028075546 7:86509646-86509668 TCGAGACCTGAATGATGAGATGG + Intergenic
1028873599 7:95795671-95795693 GTGGGAGCTAAATGATGAGAAGG + Intronic
1029171468 7:98632157-98632179 CTGGGACCTAAATGAAGAGAGGG + Intergenic
1029180176 7:98694925-98694947 CTGGGCCAGGATAGATGAGAAGG + Intergenic
1029894440 7:103967489-103967511 CTGGAACCTAATTGAAGAAAAGG - Intronic
1031841931 7:126752781-126752803 CTGAGTCCTGATTTGTGAGAAGG - Intronic
1031848688 7:126836635-126836657 CTGAGACCTGAAAGATGAGCAGG - Intronic
1031916289 7:127565912-127565934 CTGAGACCTGAGGGATGAGTAGG - Intergenic
1034345601 7:150383671-150383693 CTGGGACCTCAGGGCTGAGAAGG + Intronic
1035065979 7:156105420-156105442 GTGAGCCCTGAGTGATGAGAAGG + Intergenic
1035144035 7:156795166-156795188 CTGGGACTTGAAGGATGAGCAGG - Intronic
1037747192 8:21655229-21655251 CTGGTACCTCACTGATGAGCAGG - Intergenic
1038244346 8:25840761-25840783 CTGCGGCCTGAAGGATGAGAAGG + Intergenic
1039261807 8:35780000-35780022 ATGGGAACAGATTCATGAGATGG + Intronic
1039526631 8:38222260-38222282 CCGTGATATGATTGATGAGAAGG - Intergenic
1039586291 8:38710004-38710026 CTGAGACCTGAAGGATGAGCAGG - Intergenic
1040058218 8:43080290-43080312 CTGGGTGCTGAAGGATGAGATGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041771161 8:61473886-61473908 GTTGGACATGATTAATGAGAGGG + Intronic
1042859410 8:73297458-73297480 CTGGGCCCTCCTTAATGAGAAGG + Intronic
1043529667 8:81135393-81135415 CTGGGACCTGAATGACAAGAAGG - Intergenic
1043809490 8:84719010-84719032 CTGGCACCTGAAGGATGAGTAGG - Intronic
1044251279 8:90006324-90006346 CTGAGACCTGAAAGATGAGTAGG + Intronic
1045654363 8:104371610-104371632 CTGAGACCTGATGAATGAGTAGG - Intronic
1047289933 8:123520983-123521005 CTGAGACCTGAGGGATGGGATGG - Intronic
1047714755 8:127585274-127585296 GTGTGACCTGAGTGATCAGAAGG - Intergenic
1047927273 8:129693798-129693820 CTGGGACCTGAATGATGAGCAGG - Intergenic
1048189447 8:132274814-132274836 CTGAGATCTGAAGGATGAGAAGG + Intronic
1048474052 8:134727252-134727274 CTGAAACCTGAGTGATAAGAAGG + Intergenic
1048489986 8:134883741-134883763 CTTGGAATTGATGGATGAGAGGG + Intergenic
1048766641 8:137851800-137851822 CTGAGACCTGAATGCTAAGAAGG - Intergenic
1048884758 8:138901219-138901241 CTGAGATCTGATTAATGGGAAGG + Intronic
1049003339 8:139839685-139839707 CTGTGACCTGAAGGATGAGTAGG - Intronic
1050009661 9:1172653-1172675 CTGGGCTCTGGTTGATGTGAGGG + Intergenic
1051582906 9:18696233-18696255 CTGAGACCTGAAAGATGAGTGGG + Intronic
1052453606 9:28664766-28664788 CTGGGACCTGAATTATAACAAGG - Intronic
1052847883 9:33353381-33353403 CAGGGATCTGAGTGCTGAGATGG + Intronic
1052859917 9:33431285-33431307 CTGAGTCCTGAAGGATGAGAAGG - Intergenic
1055958346 9:81795333-81795355 CTGAGATCTGAATGAAGAGAAGG + Intergenic
1057853064 9:98580246-98580268 GGGTGACCTGATTGATGGGAAGG - Intronic
1057968618 9:99530513-99530535 CTGGGCCTTGATGGATGAGTAGG - Intergenic
1058445794 9:105053783-105053805 CAGGGATCTGAGTGAGGAGATGG - Intergenic
1058567966 9:106307134-106307156 CTGAGATCTGAAGGATGAGAAGG - Intergenic
1058976221 9:110127598-110127620 CTGGGAACTGCTTGCTGCGAGGG - Intronic
1060200507 9:121649511-121649533 CTGGAACCTGGCTGATCAGAGGG + Intronic
1060883888 9:127137167-127137189 CTGCCACCTGATTGTAGAGAAGG + Intronic
1060946527 9:127572562-127572584 TTGGGACCTGATTGGCAAGAAGG + Intronic
1061273378 9:129556574-129556596 CTGAGACCTGAAAGCTGAGAAGG + Intergenic
1062159510 9:135072391-135072413 TTGGGACATGATTGGTGAGTGGG - Intergenic
1203361718 Un_KI270442v1:222307-222329 CCGGCACCTGAATGATAAGATGG + Intergenic
1186402015 X:9268925-9268947 CTGAGACCTGAATGACGAGAGGG + Intergenic
1186607499 X:11107288-11107310 CTGAGACCTGAATGTTGAGAAGG - Intergenic
1187000178 X:15168466-15168488 CTGAGACATGAAGGATGAGAAGG - Intergenic
1187998311 X:24953489-24953511 CTGAGACCTGAATGACAAGAGGG + Intronic
1189221151 X:39373291-39373313 CTGGCACCAGTGTGATGAGAAGG + Intergenic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic
1190262058 X:48803453-48803475 CTAGGAGCGGATTGATGAGTAGG + Intronic
1190391436 X:49935644-49935666 CTGAGACCTGAAAGATGAGGAGG + Intronic
1192173146 X:68869120-68869142 CTGTGACCTGAATGAGGACAGGG - Intergenic
1192223342 X:69212095-69212117 CTGGGACCTGTATGATGAGTAGG - Intergenic
1192658085 X:73013283-73013305 CTGGGACTTGATTGAGTAGCAGG + Intergenic
1192814556 X:74577249-74577271 CTGAGACCTGAATGAATAGATGG - Intergenic
1193437779 X:81499623-81499645 CTGAGACCTGAAGGATGAGAAGG + Intergenic
1194640612 X:96399557-96399579 CTGAGAACTGATAGATGAGAAGG - Intergenic
1195468270 X:105205178-105205200 CTGAGACCTGAATGACAAGAAGG + Intronic
1195653785 X:107314706-107314728 CTGAGAGCTGAATGATGAGAAGG - Intergenic
1195690976 X:107625259-107625281 CTAGGCCTTGATTGATGAGTAGG - Intergenic
1195883418 X:109616266-109616288 CTAAGTCCTGAATGATGAGAAGG + Intergenic
1197326966 X:125106088-125106110 CTGAAACCTGAGTGATGAGAAGG - Intergenic
1197904475 X:131410263-131410285 CTGAGACCTAAGTTATGAGAAGG - Intergenic
1198568579 X:137931752-137931774 CTGCAACCTGTATGATGAGAAGG - Intergenic
1198697689 X:139360689-139360711 CTGAGTCCTGACTGATGACAGGG + Intergenic
1198914927 X:141659741-141659763 CTGAGATCTGAAGGATGAGAAGG + Intronic
1198915160 X:141662529-141662551 CAGGCACCTGAATGATGGGAGGG + Intronic
1199358051 X:146883980-146884002 TTGAGACCTGATAGAAGAGAAGG + Intergenic
1200942339 Y:8798115-8798137 CAGGCACCTGAATGATGGGAGGG + Intergenic