ID: 997280228

View in Genome Browser
Species Human (GRCh38)
Location 5:132638301-132638323
Sequence CACCCAAGGCTACACCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997280224_997280228 21 Left 997280224 5:132638257-132638279 CCCAAGTAACTGAAAGAGAGAAA 0: 1
1: 0
2: 8
3: 59
4: 674
Right 997280228 5:132638301-132638323 CACCCAAGGCTACACCTGAATGG 0: 1
1: 0
2: 1
3: 10
4: 94
997280223_997280228 29 Left 997280223 5:132638249-132638271 CCAACTCACCCAAGTAACTGAAA 0: 1
1: 0
2: 2
3: 27
4: 279
Right 997280228 5:132638301-132638323 CACCCAAGGCTACACCTGAATGG 0: 1
1: 0
2: 1
3: 10
4: 94
997280225_997280228 20 Left 997280225 5:132638258-132638280 CCAAGTAACTGAAAGAGAGAAAC 0: 1
1: 0
2: 2
3: 27
4: 347
Right 997280228 5:132638301-132638323 CACCCAAGGCTACACCTGAATGG 0: 1
1: 0
2: 1
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997280228 Original CRISPR CACCCAAGGCTACACCTGAA TGG Intronic
902041897 1:13498742-13498764 CACCCCAGGAAACACCTGCAGGG - Intronic
903579761 1:24362016-24362038 CACCCAAGGCTTCTTCTAAAAGG + Intronic
904060009 1:27701614-27701636 CACCCAAAACTACACAGGAAAGG + Intergenic
905017409 1:34787100-34787122 CACCCAAGGCCAGACCCAAATGG + Intronic
905630733 1:39516865-39516887 CAACCCAGAGTACACCTGAAGGG + Intronic
905667027 1:39769305-39769327 CAACCCAGAGTACACCTGAAGGG - Intronic
911498049 1:98654545-98654567 CACTCAAGGGTAAACCTGAAGGG - Intergenic
917995689 1:180436137-180436159 CCCCCAAGTCTACCACTGAAAGG - Intronic
922205093 1:223439286-223439308 GTCCCATGGCCACACCTGAATGG + Intergenic
922932607 1:229402234-229402256 CACAAAAGGCTACAGTTGAATGG - Intergenic
924614159 1:245598945-245598967 CTCCCAAGGGTAGACCTGCAGGG - Intronic
1067167643 10:43878290-43878312 CACCCAGCCCTATACCTGAAAGG - Intergenic
1069682237 10:70293389-70293411 CACCCAAAGCTTGACGTGAAAGG - Intergenic
1069740470 10:70683910-70683932 CTCCCAAGGCTAGGCCTCAAGGG - Intronic
1071532178 10:86398877-86398899 GACCCAAGGATTAACCTGAAGGG + Intergenic
1072273678 10:93801819-93801841 GCTCCGAGGCTACACCTGAAGGG + Intergenic
1072665624 10:97390453-97390475 CAGCCCATGGTACACCTGAAGGG + Exonic
1076201395 10:128561441-128561463 CACTCAAGGAGAAACCTGAATGG - Intergenic
1079861707 11:25680699-25680721 AACCCATGGCAACATCTGAATGG - Intergenic
1083568219 11:63738740-63738762 CTCCCAAGTATACACCTCAAAGG - Intronic
1089118194 11:116113037-116113059 CAACCAGAGCTAGACCTGAAGGG - Intergenic
1091137311 11:133203436-133203458 CTCCCATGGCTTCACCTGAGAGG - Intronic
1097540706 12:60938540-60938562 CACCATAGCCTACACCTGACAGG + Intergenic
1098805443 12:75016098-75016120 TTCCCAAGGCTCCACCTCAATGG + Intergenic
1100103852 12:91144201-91144223 CACTCAAGGCTACACCATAAAGG + Exonic
1101008311 12:100424429-100424451 GAACCAAGGCTAGAGCTGAATGG - Intergenic
1102417691 12:112778944-112778966 CACCCAAACCTCCACCTGAAAGG + Intronic
1103890021 12:124231735-124231757 CACTCAAGGCTCCTCCTGAGGGG + Intronic
1104089346 12:125501905-125501927 AAATCAATGCTACACCTGAACGG - Intronic
1104870373 12:131990998-131991020 CACCCAAGGATCCTCCTGCATGG - Intronic
1106239828 13:27902619-27902641 CACTCTAGGATACAACTGAATGG + Intergenic
1106876687 13:34082206-34082228 TCCCCAAGTCTACAGCTGAAAGG + Intergenic
1108669326 13:52667888-52667910 CACACAATTCTACAGCTGAAAGG - Intronic
1109487537 13:63047054-63047076 AACCCAAGGCTAAAACTAAAGGG + Intergenic
1118590956 14:67400607-67400629 CACCCAAGGCTGTAGCTGGAAGG + Intronic
1118939729 14:70322097-70322119 CGCCCATGCCTATACCTGAATGG + Intergenic
1124426634 15:29568937-29568959 AACCCAAGGCTAAACCAGGAAGG + Intronic
1127015527 15:54682178-54682200 CCCCCATGGCTACACATTAATGG + Intergenic
1128180222 15:65596085-65596107 CAGCCAAGGCAAAAACTGAAAGG + Intronic
1128368245 15:67020151-67020173 CACACAAGCCTCCACCTGGATGG + Intergenic
1132945010 16:2527766-2527788 CTCCCAGGGCTGCACCTGGAGGG + Exonic
1137049706 16:35698124-35698146 CTCCCAAGGCTAAACCTGGAAGG - Intergenic
1140176495 16:72665284-72665306 CACCCAACGATTTACCTGAACGG + Intergenic
1142875848 17:2851943-2851965 CACAGAAGGCTGCACCTCAACGG - Intronic
1143025867 17:3941757-3941779 CACCCAAGGGTACACACGCAAGG + Intronic
1145905610 17:28514597-28514619 CACCCAGGGCTCCACCCGACAGG - Intronic
1146658602 17:34649799-34649821 CGCCCTAGGTCACACCTGAAGGG + Intergenic
1150621640 17:66812256-66812278 CACCCAAGTTTACCCCTGCAGGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1155491588 18:26406207-26406229 CACCCATGGCTATACTTGGAAGG - Intergenic
1161377357 19:3946818-3946840 TACCCAAGACCACACATGAAAGG + Intergenic
1161593286 19:5138313-5138335 CCCCCAAGGCCACACCTGACGGG - Intronic
925160254 2:1678402-1678424 CACCTAACTGTACACCTGAACGG + Intronic
929497942 2:42462924-42462946 CCCCCAAGTCTACAGCTAAAAGG + Intronic
931212598 2:60212222-60212244 CACCCAAGACAACACCCAAAGGG + Intergenic
936491627 2:112977514-112977536 CACCTAAGGCCACACCTGAATGG - Intronic
946546245 2:220747253-220747275 GACCCAAGGAATCACCTGAAAGG - Intergenic
948233577 2:236370258-236370280 CACCCCAGGCTGCACCTGCACGG - Intronic
1173850134 20:46212569-46212591 TACCCAAGGTCACACCTGTAAGG - Intronic
1177101980 21:16909220-16909242 TCCCCAAGGCAACACCAGAATGG + Intergenic
1179474491 21:41634503-41634525 CAGCCAAGAATGCACCTGAAAGG - Intergenic
1180742631 22:18064473-18064495 CACCCCAGCCCCCACCTGAATGG - Intergenic
957215575 3:77316537-77316559 CCCCCAAGTCTACTACTGAAAGG + Intronic
965864621 3:173190867-173190889 GACCCAAGGCTTCACCAGATGGG + Intergenic
967770622 3:193330160-193330182 CAACCAAGGCTGCACCTCAAAGG + Intronic
973897137 4:55424540-55424562 CACCCACGGCTACACCATAGGGG - Exonic
976618290 4:87100455-87100477 CACCCCAGGTCACAGCTGAAAGG - Intronic
981280526 4:142953449-142953471 CACCCATGGCTTCTCCAGAATGG + Intergenic
988059362 5:26147783-26147805 CACATAAGGCTACACCTGTTAGG + Intergenic
989456155 5:41646778-41646800 TTCCCAAGGTTACACCTCAATGG - Intergenic
993519715 5:88885293-88885315 GTCCCAAGGCTTCACTTGAAAGG + Intronic
997280228 5:132638301-132638323 CACCCAAGGCTACACCTGAATGG + Intronic
1000613635 5:163403441-163403463 CACCAAATGCTAAAACTGAATGG - Intergenic
1003523978 6:6883204-6883226 CACCAATGGCCACACCTGCAGGG + Intergenic
1009940908 6:70286827-70286849 TACCAAAGGCTACAGCAGAATGG + Intronic
1013323738 6:109022818-109022840 AACCCAAGGCCACACATCAAGGG + Intronic
1017753495 6:157510441-157510463 CACCCAAGACCACACCAGGACGG - Intronic
1022842500 7:34178191-34178213 CACCCATGGCTAGACCAAAAAGG + Intergenic
1023413580 7:39911046-39911068 CATGCAAGGCTAAACCTGGAGGG - Intergenic
1025824290 7:64998059-64998081 CACTCCAGGCTACACCTCAAAGG - Intronic
1027687382 7:81294798-81294820 CACCCATGGCTGCGCCTGGATGG - Intergenic
1030201945 7:106914709-106914731 CTCCCAAGGCTTGACTTGAAAGG - Intergenic
1030656099 7:112169667-112169689 CACTAAAGGCTACACGAGAAAGG - Intronic
1032467338 7:132154237-132154259 AACCCAAGGAAACACCTGACAGG + Intronic
1032534092 7:132646256-132646278 CATCCGAGGATACAGCTGAAGGG + Intronic
1038490997 8:27971148-27971170 CTCCCAAGGCTGCATCTGAAAGG - Intronic
1042227943 8:66529323-66529345 AACGCATGGCTACATCTGAAAGG - Intergenic
1044666927 8:94641139-94641161 CACCCAAGCCCACACCTGGTCGG - Exonic
1045457458 8:102395308-102395330 CACCCAAGACTAGAACTGACAGG + Intronic
1045713085 8:105009302-105009324 CACCCATGGCCATAGCTGAATGG - Intronic
1046152734 8:110249520-110249542 TACCCAAGTCCACACCTGAAGGG - Intergenic
1048037908 8:130694520-130694542 CACCCAAGGTCACACGTGTACGG - Intergenic
1049958927 9:719720-719742 CACCCAAAACTAGAGCTGAATGG - Intronic
1050457874 9:5850793-5850815 TACCAAATGCTATACCTGAAAGG + Intergenic
1050652978 9:7792967-7792989 CACGGAAGGCTTCACCGGAAAGG + Intergenic
1052347653 9:27426524-27426546 CACACAATGCTACCCCTGCAGGG + Intronic
1058957648 9:109963871-109963893 CACCCTAGCCTGCACCTCAAAGG - Intronic
1062015833 9:134290883-134290905 CACCCAAGCCCACACCAGCAGGG - Intergenic
1186555138 X:10550248-10550270 CACAGACGGCTACACCTGGAAGG + Intronic
1192587370 X:72329617-72329639 CTCCCAGGGCTCCACCTGGATGG + Exonic
1193347218 X:80417943-80417965 CGACCAAGTCTACACCTGATTGG - Intronic
1194283529 X:91982436-91982458 CCCCCAAGTCTACCACTGAAAGG + Intronic
1198334434 X:135652930-135652952 CAACCAAGGAAACACCTGACAGG + Intergenic
1198541839 X:137648287-137648309 CACCCAAGGCCACACATGGGAGG - Intergenic
1198960039 X:142174231-142174253 CACCTCAGGGTACAGCTGAAAGG + Intergenic
1200601104 Y:5206999-5207021 CCCCCAAGTCTACCACTGAAAGG + Intronic