ID: 997280721

View in Genome Browser
Species Human (GRCh38)
Location 5:132643061-132643083
Sequence GGTCAGAGCTTTCCAAAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997280721 Original CRISPR GGTCAGAGCTTTCCAAAGGT GGG (reversed) Exonic
901890566 1:12259963-12259985 GGTCAGTGCTGTCCAAAGTGTGG + Intronic
903866780 1:26405010-26405032 GGACAGAGCTTTTCAAAGCATGG - Intergenic
905783675 1:40734995-40735017 AGTTAGAGCTGTCCAAAGATGGG + Intronic
906496490 1:46307784-46307806 GGTCAGAGCTTAACTAAGGATGG - Intronic
909111615 1:71485606-71485628 GGTCAGTGTTTGCCAAGGGTTGG - Intronic
909926579 1:81444608-81444630 GGTGGCAGCTTTCCAATGGTTGG + Intronic
911191650 1:94954728-94954750 GGTCAGTGCTTTCCAAGGCCCGG - Intergenic
913158416 1:116123083-116123105 GGTCAGAGCTTTCCAGGAGGAGG + Intronic
915229042 1:154432311-154432333 TGACAGAGCTTTCCACAGGCTGG - Intronic
915526883 1:156481336-156481358 GGTCAGGGCTTACCACAGGGTGG - Intronic
916311999 1:163407943-163407965 GGTCAGTGCTTGCCACAAGTAGG + Intergenic
916877030 1:168980221-168980243 GGACAGAGCTTTCCAAGGAGAGG - Intergenic
918426501 1:184415529-184415551 GGTCAGTGCTTTCCAAACTGTGG + Intronic
918670994 1:187216566-187216588 AGTCAGATCTTTCCTAAGATGGG + Intergenic
921683024 1:218056414-218056436 GATGAGTGCTTTCCAAAGGCTGG - Intergenic
923160916 1:231313866-231313888 GGGAAGAGCTATCCAGAGGTGGG + Intergenic
1066119260 10:32267927-32267949 GGTCAAATATTTCCAAAGGAAGG + Intronic
1066680924 10:37936565-37936587 ACTCAGATCTTTCCTAAGGTAGG - Intergenic
1066746421 10:38606279-38606301 GGCCATAGCCTCCCAAAGGTGGG + Intergenic
1069969858 10:72157372-72157394 GGTGAGAGCTTTAAAAATGTCGG - Intronic
1071568294 10:86682739-86682761 GCTCAGAGCTTTACAAGTGTTGG - Intronic
1077390695 11:2299490-2299512 GGACACAGCTTTCCAGAGGAGGG + Exonic
1077517035 11:3008194-3008216 GGTCAGTGCTGCCCAAAGGCAGG - Intronic
1080062430 11:27971254-27971276 GGGCAGACATTCCCAAAGGTGGG - Intergenic
1080661139 11:34296932-34296954 GGTCAGAGCTGTGCAGAAGTTGG - Intronic
1081668497 11:44930323-44930345 AGTCAGAGCAGTCCAAAGGCAGG - Exonic
1083151392 11:60793931-60793953 GGTAACAGCTGTCCAAAGGGTGG - Intronic
1087818623 11:102686937-102686959 GGTCACTGATTGCCAAAGGTGGG - Intergenic
1089291137 11:117438568-117438590 GATCAGTGCTTTCCAAGTGTGGG - Intronic
1089394209 11:118124979-118125001 GGCCAGAGCTTTACAACTGTGGG - Intergenic
1090452787 11:126821372-126821394 GGTAAGCCCTTTCCAAAGGAAGG - Intronic
1091584389 12:1807759-1807781 GGTCAGAGCTGTCCAGAGTGAGG + Intronic
1091613861 12:2034416-2034438 GGTCAGAGTTGTCCAGAGATGGG + Intronic
1092112885 12:5976446-5976468 GGTCATAGCTTTTCTAAGGCTGG - Intronic
1096715670 12:53489843-53489865 GGTTAGAGCTTTACAAATCTAGG - Intronic
1096778801 12:53980123-53980145 GGACAGACTTCTCCAAAGGTAGG + Intergenic
1098205954 12:68109854-68109876 GGGCAGAGAATTCCAAATGTGGG - Intergenic
1098475116 12:70892036-70892058 GGTCAGAGGTTTCCAAATTGTGG - Intronic
1108426850 13:50310951-50310973 GGGCAGAGCTTCCCAATGGGTGG + Intronic
1109965960 13:69695712-69695734 GATCAGAGATTTACTAAGGTGGG + Intergenic
1110977932 13:81863974-81863996 GAATAGAGGTTTCCAAAGGTAGG + Intergenic
1115973578 14:38972564-38972586 GGGCAGAGATTTCCAAAGACTGG - Intergenic
1116665334 14:47767226-47767248 GGTCTGAGTCTTCCAAAGTTAGG + Intergenic
1117441161 14:55760661-55760683 GCTCATACCTTTCCAATGGTGGG + Intergenic
1122411486 14:101528256-101528278 GCTCAGGGCTTTCCCAGGGTGGG + Intergenic
1122474864 14:102000323-102000345 GGTCAGAACTTTCTAAGGTTTGG + Exonic
1128818093 15:70629179-70629201 CGTCAGATCTGTCCCAAGGTGGG + Intergenic
1131571872 15:93545993-93546015 GATGAGAGCTTAGCAAAGGTGGG + Intergenic
1131635675 15:94231134-94231156 GGTCAGGGCGTTACAAAGGGAGG + Intergenic
1132270118 15:100516828-100516850 GTTCCAAGCTTTCCAAAGATGGG + Intronic
1133483353 16:6193803-6193825 GAACAGAGCTTTCAAAAGGAAGG - Intronic
1134006568 16:10822204-10822226 GGCCAGTGTTTCCCAAAGGTCGG - Intergenic
1134674964 16:16083765-16083787 GTCCACAGCTTTCCAAAGGGGGG + Intronic
1136736638 16:32473363-32473385 GGCCATAGCCTCCCAAAGGTGGG - Intergenic
1137006074 16:35275311-35275333 ACTCAGATCTTTCCTAAGGTAGG + Intergenic
1138141508 16:54572504-54572526 GATCAGTGCTTTCCAAGGATAGG - Intergenic
1138200787 16:55086779-55086801 TGTCATAGCTTTCCATGGGTGGG + Intergenic
1139740955 16:69034437-69034459 GGTCAGTGCATTCCACAGGGAGG - Intronic
1139902437 16:70338772-70338794 AGTCAGAGTTTTTCGAAGGTAGG - Intronic
1140050592 16:71477797-71477819 GGCCAGATCTTCCCAAAAGTTGG - Intronic
1140311814 16:73856724-73856746 GATTAGAGCTTTCCAAAGGGTGG - Intergenic
1141148805 16:81550391-81550413 GGCCAGACCTTCCCAAAGCTGGG - Intronic
1142424010 16:89991136-89991158 GGTCAGAGGTTTCCAAGGAGAGG + Intergenic
1203016430 16_KI270728v1_random:356214-356236 GGCCATAGCCTCCCAAAGGTGGG + Intergenic
1203034765 16_KI270728v1_random:629372-629394 GGCCATAGCCTCCCAAAGGTGGG + Intergenic
1143589252 17:7871217-7871239 GGTCAGAGCTATTGAGAGGTGGG - Intronic
1144152627 17:12464905-12464927 GATCAGTGCTTGCCAAGGGTTGG - Intergenic
1144226602 17:13155363-13155385 GGGCAGATCATTCAAAAGGTTGG - Intergenic
1145839051 17:27978305-27978327 GGTCATAGGGTTCCAAAAGTGGG + Intergenic
1148915098 17:50969843-50969865 AGTCAGTTCTTTCCAAGGGTAGG - Intronic
1151283530 17:73093540-73093562 GGGCAGTGCTTTTCAAAGGGTGG - Intergenic
1153314754 18:3710896-3710918 GGTCAGAGCTCTCCATGTGTGGG + Intronic
1155563138 18:27102114-27102136 GGTCAGTGTTTTCCAAAGTTTGG + Intronic
1155650776 18:28138870-28138892 GGTGAGAGCACTCCAAAGATGGG + Intronic
1159207607 18:65273697-65273719 AGGTAGAGATTTCCAAAGGTTGG + Intergenic
1159925141 18:74262490-74262512 GGCCAGTGTTTTCCAAAAGTTGG + Intronic
1165272608 19:34723780-34723802 ACTCAGATCTTTCCTAAGGTAGG - Intergenic
1166358328 19:42240571-42240593 GGTTAGTGCTTTCCTAAAGTAGG - Intronic
1167480900 19:49730559-49730581 GGAAGGAGCTTTCCAAAGGTAGG + Intergenic
927142214 2:20138133-20138155 GGTCAGGGCTTGCCTGAGGTGGG + Intergenic
933534961 2:83559882-83559904 GGTCAGAGCTCTTTAAAGGCAGG + Intergenic
933591002 2:84232442-84232464 GGGCAGAGCTTCTAAAAGGTAGG + Intergenic
933616810 2:84490483-84490505 GGTCAGTGATTACCAATGGTTGG - Intergenic
934308824 2:91845468-91845490 GGCCATAGCCTCCCAAAGGTGGG + Intergenic
935080380 2:99787346-99787368 GGTCACAGCTATCCGAAGGCAGG - Intronic
935243428 2:101197752-101197774 GGTCTGAGTTTTCTAAAGGCAGG + Intronic
935725114 2:106017221-106017243 GGGCAGACCTTTCCAAATTTAGG + Intergenic
937041156 2:118821679-118821701 GGCCAAAGCTTTCAAAATGTGGG - Intergenic
937441239 2:121917945-121917967 GGCCATGGCTTTCCAATGGTGGG + Intergenic
939997052 2:148929742-148929764 GGTCAGAGATTTTTAAAAGTTGG + Intronic
940788197 2:158004450-158004472 ATTCAGAGCTTTACAAAAGTAGG - Intronic
941297414 2:163757412-163757434 GATCAGAGATTTCCAGAAGTAGG + Intergenic
944280460 2:197890408-197890430 GGACAGGGATTTCCAAAGGTTGG - Intronic
945932549 2:215869987-215870009 AGTCAGATCTTTCCCATGGTTGG - Intergenic
946448670 2:219761396-219761418 GGTCAGAGACCTCCAAAGGGTGG + Intergenic
946940507 2:224764908-224764930 GATCAGAGGTTTCCAAATGTAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947812047 2:233010861-233010883 GGTCTGACCTCTCCCAAGGTGGG + Intronic
948275718 2:236706425-236706447 GTTCAGAGCTCCCCACAGGTGGG + Intergenic
1170784635 20:19456793-19456815 GGTCAAAGCTGTCCCAAGGCAGG - Intronic
1172906084 20:38370449-38370471 TTTTAGAGCTTTCCAAGGGTAGG + Intronic
1173017201 20:39236534-39236556 GTTCTGAGCTTCCCAAAGGTAGG + Intergenic
1173233062 20:41217521-41217543 GGTCAGCATTTTCCAAAGGAAGG - Intronic
1173681095 20:44882619-44882641 GGTCTGCGGTTGCCAAAGGTTGG + Intergenic
1176154374 20:63610847-63610869 GGTCAAAGCTCTTCAAAGCTTGG - Intronic
1180535909 22:16392556-16392578 GGCCATAGCCTCCCAAAGGTGGG + Intergenic
1184825224 22:46946091-46946113 GTACACAGCTTTCCAAAGGGAGG + Intronic
949345292 3:3071014-3071036 GGTCAGAACTGTCCAAAGTTAGG - Intronic
953819209 3:46189712-46189734 TGTCATATCTTTCCAAAGCTGGG - Intronic
954517278 3:51190106-51190128 TCTCAGATCTTTCCAATGGTGGG - Intronic
959003389 3:100990906-100990928 GGTCAGTGGTTTCCAAATATTGG + Intronic
961671815 3:128537827-128537849 GATGAGAGCTTTCCAGAGGTTGG - Intergenic
961983950 3:131112733-131112755 GGTCAGAGCTTTCCAGATATAGG + Intronic
962049857 3:131801681-131801703 GGTTAGTGCTTTCCAAAACTGGG + Intronic
962412503 3:135153536-135153558 GGTCAGAGTTTTCCAAATGAGGG - Intronic
962979260 3:140473048-140473070 GGTCAGAGTTGTGCAATGGTTGG + Intronic
963710552 3:148742250-148742272 GTTCAGAGCTTTAGAAAAGTCGG - Exonic
964498569 3:157322914-157322936 GATGAGAGCTTTCCAAAAGTAGG + Intronic
964927224 3:161974528-161974550 GGTCTGAGCTCCCCAAAGGGTGG + Intergenic
965776336 3:172235596-172235618 GGTCAGAGTATTCCAAACATGGG + Intronic
967146270 3:186608971-186608993 GGTCAGAGTTTCTCAGAGGTTGG - Intergenic
968970309 4:3790250-3790272 AGTCCGAGCTTTCCTAAGTTAGG + Intergenic
970052816 4:11934731-11934753 AGTCATGGCTTTCCCAAGGTAGG - Intergenic
970398803 4:15698109-15698131 GGTCAGAGTTTGTCAAAGGGTGG - Intronic
970617349 4:17780893-17780915 GGTCTGTGCTTTTCCAAGGTGGG - Intronic
979066367 4:116139989-116140011 GTTCAGAGCTCCACAAAGGTAGG + Intergenic
983772713 4:171571046-171571068 GAAAAGAGGTTTCCAAAGGTTGG + Intergenic
984974066 4:185214906-185214928 GGTCAGAGCTTTGCAATAGGTGG + Intronic
987492050 5:18593943-18593965 GGGCAGAGCTGTCCAAAGCTTGG - Intergenic
988959415 5:36354698-36354720 GGTCAGAGTTTTCCAAATTGTGG - Intergenic
990346039 5:54872731-54872753 GTTCAGAGCTTTCCAGAGTTGGG - Intergenic
992856850 5:80870674-80870696 GATAAGAGCTTTCCAAGGGTGGG - Intronic
993393744 5:87356276-87356298 GGGCAGTGGTTGCCAAAGGTTGG - Intronic
993966915 5:94370246-94370268 GGTCAGTGGTTGCCACAGGTTGG + Intronic
996245802 5:121262979-121263001 GGCCAGAGCATTCCAATGGGTGG + Intergenic
996456485 5:123689614-123689636 GGTTAGTGGTTGCCAAAGGTTGG + Intergenic
997280721 5:132643061-132643083 GGTCAGAGCTTTCCAAAGGTGGG - Exonic
1000594270 5:163195971-163195993 GGGCAGGGCATTCCAAAGTTAGG - Intergenic
1001255324 5:170178813-170178835 TTTGAGAGCTTTCCAAAGGAAGG - Intergenic
1005211058 6:23464245-23464267 GGTCAGAGGTTACCAAGGTTTGG + Intergenic
1006704897 6:36011342-36011364 GCTCAGAGAATCCCAAAGGTAGG - Intronic
1006778521 6:36615757-36615779 GTTCAGAGCTTTAGAATGGTAGG + Intergenic
1008890629 6:56485690-56485712 GGTCCATGGTTTCCAAAGGTGGG - Intronic
1018094501 6:160373751-160373773 GGACAGAGCTCACCAAAGCTTGG - Intronic
1023124641 7:36943351-36943373 AGGCAGAGCTTACAAAAGGTAGG - Intronic
1026876373 7:73881382-73881404 GGTCACAGGTGTCCCAAGGTGGG - Intergenic
1031232418 7:119125250-119125272 GGTCTAAGCCTTCCAAACGTAGG - Intergenic
1036499927 8:9304416-9304438 GGTCAGATCTTCCCAAAGCTAGG - Intergenic
1042022186 8:64379684-64379706 CTTCAGATCTTTCCAAAGTTTGG - Intergenic
1042801295 8:72720989-72721011 GATCAGAGCTTTTTAAAGATTGG + Intronic
1042818785 8:72907680-72907702 AGTCAGACCTTGCCAAATGTAGG + Intronic
1043811319 8:84744669-84744691 ATTCAGAGCTTTTCAAAGGAAGG + Intronic
1044342283 8:91060189-91060211 GGTCAGATATCTCCATAGGTAGG - Intergenic
1044899223 8:96926273-96926295 GGTCAGAGCTGCCCAAAGATGGG - Intronic
1045279569 8:100738238-100738260 GGTCAGAGCTTTCCAGACAGAGG + Intergenic
1045551468 8:103176645-103176667 GGGCAGAGGTTTCCAAAAGGCGG - Intronic
1047783375 8:128129477-128129499 GGTCGGAGCGTTCCCAAAGTGGG - Intergenic
1051713713 9:19959512-19959534 AGTAAGAGTTTTCAAAAGGTAGG - Intergenic
1053165318 9:35840360-35840382 GGTCAGCGCTTCCCCCAGGTGGG + Intronic
1053484620 9:38442466-38442488 TGTCAGAGCTGTCCAAAAGCGGG + Intergenic
1054694894 9:68350897-68350919 AGTAAGTGCTTTCCAAAGTTGGG + Intronic
1055473681 9:76639873-76639895 TGCCAGAGCTTTCAAAAGATGGG - Intronic
1060169633 9:121450958-121450980 GATCTGAGCTTTGCCAAGGTGGG - Intergenic
1188444321 X:30240640-30240662 GTTCAGTGGTTTCCAAAGGTTGG - Intergenic
1188518388 X:31011854-31011876 GGTCAGTGGTTGCCAGAGGTTGG + Intergenic
1189744946 X:44159256-44159278 GGTCAGAGTTTGTCACAGGTGGG - Intronic
1192194854 X:69021379-69021401 GGCCAGTGCTTCCCAAAGATGGG + Intergenic
1193878032 X:86886215-86886237 GATCAGTGGTTTCCAAGGGTTGG + Intergenic
1195115397 X:101693380-101693402 AGTCAGAGCTTCCAAAAGGAAGG - Intergenic
1197270019 X:124415032-124415054 GGTCAGAGCAGTGCTAAGGTCGG - Intronic
1198450613 X:136763868-136763890 TCTCAGAACTTTTCAAAGGTAGG - Intronic
1200112072 X:153745432-153745454 GGCCACAGCCTCCCAAAGGTGGG + Intergenic
1201738342 Y:17296109-17296131 GGACACAGCTTGACAAAGGTTGG - Intergenic