ID: 997281209

View in Genome Browser
Species Human (GRCh38)
Location 5:132647277-132647299
Sequence ATGAAGAAGCAGATTTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997281209_997281211 -6 Left 997281209 5:132647277-132647299 CCATCCAAAATCTGCTTCTTCAT No data
Right 997281211 5:132647294-132647316 CTTCATAAAAGCAATAAGACTGG No data
997281209_997281212 29 Left 997281209 5:132647277-132647299 CCATCCAAAATCTGCTTCTTCAT No data
Right 997281212 5:132647329-132647351 AATCAACTTTTTCAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997281209 Original CRISPR ATGAAGAAGCAGATTTTGGA TGG (reversed) Intergenic
No off target data available for this crispr