ID: 997281319

View in Genome Browser
Species Human (GRCh38)
Location 5:132648725-132648747
Sequence CTCATTATGATTGGTATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997281319_997281323 5 Left 997281319 5:132648725-132648747 CCAAGTATACCAATCATAATGAG No data
Right 997281323 5:132648753-132648775 CAGAAGAGAGAGAGAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997281319 Original CRISPR CTCATTATGATTGGTATACT TGG (reversed) Intergenic
No off target data available for this crispr