ID: 997281323

View in Genome Browser
Species Human (GRCh38)
Location 5:132648753-132648775
Sequence CAGAAGAGAGAGAGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997281318_997281323 13 Left 997281318 5:132648717-132648739 CCAAAATGCCAAGTATACCAATC No data
Right 997281323 5:132648753-132648775 CAGAAGAGAGAGAGAGAGAAAGG No data
997281320_997281323 -4 Left 997281320 5:132648734-132648756 CCAATCATAATGAGAATCCCAGA No data
Right 997281323 5:132648753-132648775 CAGAAGAGAGAGAGAGAGAAAGG No data
997281319_997281323 5 Left 997281319 5:132648725-132648747 CCAAGTATACCAATCATAATGAG No data
Right 997281323 5:132648753-132648775 CAGAAGAGAGAGAGAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997281323 Original CRISPR CAGAAGAGAGAGAGAGAGAA AGG Intergenic
No off target data available for this crispr