ID: 997281820

View in Genome Browser
Species Human (GRCh38)
Location 5:132653793-132653815
Sequence TCCTGCAGCAGGGTTTTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997281817_997281820 7 Left 997281817 5:132653763-132653785 CCATTTTTGTTCATCAAAGTCGA No data
Right 997281820 5:132653793-132653815 TCCTGCAGCAGGGTTTTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997281820 Original CRISPR TCCTGCAGCAGGGTTTTCTC CGG Intergenic
No off target data available for this crispr