ID: 997282260

View in Genome Browser
Species Human (GRCh38)
Location 5:132656507-132656529
Sequence CCGCGCGTGGGAGAAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997282260_997282276 14 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282276 5:132656544-132656566 ACCGCTCCCGGCAGGGCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 107
997282260_997282273 7 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282273 5:132656537-132656559 CCTGCCCACCGCTCCCGGCAGGG 0: 1
1: 0
2: 1
3: 26
4: 221
997282260_997282278 17 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282278 5:132656547-132656569 GCTCCCGGCAGGGCTTTTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 154
997282260_997282268 2 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282268 5:132656532-132656554 GCGCCCCTGCCCACCGCTCCCGG 0: 1
1: 0
2: 3
3: 33
4: 383
997282260_997282271 6 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282271 5:132656536-132656558 CCCTGCCCACCGCTCCCGGCAGG 0: 1
1: 0
2: 1
3: 28
4: 379
997282260_997282282 24 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282282 5:132656554-132656576 GCAGGGCTTTTGGTGGCCATGGG 0: 1
1: 0
2: 1
3: 18
4: 204
997282260_997282284 26 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282284 5:132656556-132656578 AGGGCTTTTGGTGGCCATGGGGG 0: 1
1: 0
2: 5
3: 176
4: 3904
997282260_997282283 25 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282283 5:132656555-132656577 CAGGGCTTTTGGTGGCCATGGGG 0: 1
1: 0
2: 5
3: 39
4: 399
997282260_997282281 23 Left 997282260 5:132656507-132656529 CCAGCGCCTTCTCCCACGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 997282281 5:132656553-132656575 GGCAGGGCTTTTGGTGGCCATGG 0: 1
1: 0
2: 2
3: 33
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997282260 Original CRISPR CCGCGCGTGGGAGAAGGCGC TGG (reversed) Intronic
900138367 1:1128335-1128357 CCCCATGTGGGAGAAGCCGCGGG - Intergenic
900613776 1:3555282-3555304 CTGAGCGTGGGTGGAGGCGCAGG - Intronic
902067567 1:13700504-13700526 CCGCGGGTGGGTGGCGGCGCCGG + Intronic
902243000 1:15101060-15101082 CAGCGAGGGTGAGAAGGCGCAGG - Intronic
902394413 1:16124873-16124895 CCTCATGTGGGAGAAGGCGGAGG + Exonic
902670592 1:17970634-17970656 CTGGGCGTGGCAGCAGGCGCTGG - Intergenic
903255325 1:22094438-22094460 CCGGGCGTGGTAGCGGGCGCCGG - Intergenic
903321484 1:22546016-22546038 CCCCGCGTGGGAGGAGGAGATGG + Intergenic
903646785 1:24900877-24900899 CCGCGGGGGGGAGAGGGGGCGGG + Exonic
903813254 1:26046369-26046391 CCGCGCGGGAGAGGGGGCGCAGG - Intergenic
905800361 1:40838836-40838858 CCGGGAGTGGGAGCGGGCGCTGG + Exonic
906653838 1:47533631-47533653 CAGGGGGTGGGAGAAGGCGGAGG + Intergenic
923558779 1:235022642-235022664 CCGTGCGTGTGAGCAGGAGCTGG + Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1067197573 10:44135514-44135536 CCCCCAGTGGGAGAAGGCCCTGG - Intergenic
1067497738 10:46774813-46774835 CCGCGCGCGGGATAGCGCGCCGG + Intergenic
1071603069 10:86968406-86968428 CCGCGTAGGGGAGAGGGCGCGGG - Exonic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1077103633 11:832827-832849 ACCCGCGTGGGTGTAGGCGCTGG - Exonic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1078066240 11:8081170-8081192 CGGGGCGAGGGAGAAGGGGCAGG + Intronic
1078871945 11:15355233-15355255 CCGGGCGTGGTGGCAGGCGCCGG + Intergenic
1081672852 11:44951070-44951092 GCGCGCCCGAGAGAAGGCGCCGG + Intronic
1081969092 11:47186114-47186136 CCGCCCGGGGGAGGCGGCGCCGG - Intronic
1083667808 11:64285177-64285199 CCGCGCCTGGGAGGAGGAGCGGG - Intronic
1083941586 11:65899322-65899344 CCGGGAGTGGGAGATGCCGCCGG - Intronic
1084165485 11:67373151-67373173 CTGCGGGTGGGAGGAGGGGCTGG - Intronic
1084171123 11:67401544-67401566 CCGCGCGTCGGAGCTGGCCCCGG + Intronic
1084251564 11:67903373-67903395 CCGCGCGTGGTGGCGGGCGCCGG + Intergenic
1084526951 11:69703784-69703806 CCCCGCGTCCGAGAAGGCGAGGG + Exonic
1084546755 11:69818613-69818635 CCCCGCGGGGGAGGCGGCGCCGG - Intronic
1091807295 12:3365841-3365863 CGGCGCGTGGGAGCACGCGTTGG - Intergenic
1091915390 12:4269395-4269417 CCACACGTGGGGGAAGGGGCTGG - Intergenic
1101381208 12:104215710-104215732 CCGCGGGTCGGAGAACGCGGTGG - Intergenic
1103659231 12:122500543-122500565 CCGGGCGAGGGCGAGGGCGCGGG - Exonic
1121111012 14:91313187-91313209 CCGCGCGCTGGACAAGGAGCTGG - Exonic
1124612116 15:31215900-31215922 CCGCGCCTGGGAGAGGCCTCCGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128545366 15:68562832-68562854 CCGGGCGTGGTGGCAGGCGCCGG + Intergenic
1128582182 15:68818196-68818218 CCGCGCCGGGGAGGAGGGGCGGG + Intronic
1129115239 15:73361974-73361996 CCTGGCTGGGGAGAAGGCGCAGG - Intronic
1129450286 15:75647703-75647725 CCGCGCGGAGGAGTAGGCGGGGG + Intronic
1130960135 15:88653597-88653619 CAGAGCCTGGGAGAAGGCCCTGG - Intronic
1133218463 16:4307646-4307668 CCCCGCGTGGGGGTAGGGGCGGG + Intergenic
1136365676 16:29808037-29808059 CTTCGCGTGGGAGGAGGCGGCGG + Intronic
1139691499 16:68644883-68644905 CCGCGTGTGGGAGGACGCACGGG + Exonic
1142169143 16:88611468-88611490 CCGCGACCGGGAGAAGGAGCGGG + Exonic
1142316248 16:89347466-89347488 CCGGGCGTGGTGGCAGGCGCCGG + Intronic
1144902663 17:18611759-18611781 CCGGGCGTGGTGGAGGGCGCCGG - Intergenic
1145876167 17:28319547-28319569 CGCCGCTTGGGAGAAGGGGCTGG - Intronic
1146673861 17:34759749-34759771 GCACGCGTGGGAGAAGGAGGAGG - Intergenic
1147168521 17:38605479-38605501 CCGGGCTTGGGAGAAGGACCCGG - Intronic
1150840484 17:68601416-68601438 CCGAGCGAGGGGGAGGGCGCAGG - Intergenic
1151732218 17:75918161-75918183 CCGCGTGTGGGAGGTGGCACTGG + Exonic
1153457527 18:5296264-5296286 CCGCGCGCGGGAGAAGGAGTGGG + Intronic
1153805215 18:8705060-8705082 GCGCCCTTGGGAGCAGGCGCAGG - Intergenic
1155199375 18:23503731-23503753 CCGCGCGGGGGAGGAAGCGCGGG - Intronic
1155392730 18:25352329-25352351 CGGCGCGTGGGAGGCGGCGGCGG - Intergenic
1155928717 18:31684775-31684797 CTGCAGGTGGGAGGAGGCGCAGG + Intronic
1158461328 18:57648599-57648621 CCGCTGGTGCGAGAAGGCGTAGG + Exonic
1159334597 18:67045671-67045693 CCGGGCGTGGTGGAGGGCGCCGG - Intergenic
1160025323 18:75211438-75211460 CGGCTCGCGGAAGAAGGCGCAGG + Intronic
1160029741 18:75248952-75248974 CTCCGCGTGGGAGGAGGCCCAGG + Intronic
1160961866 19:1725716-1725738 CCGCGCGGGGGCGCATGCGCGGG + Intergenic
1161408406 19:4102942-4102964 CCCCGCGTGGGAGGAGGCGGCGG + Intronic
1162735703 19:12745798-12745820 CCGGGAGTGGGAGTAGGCCCGGG + Intronic
1164179616 19:22807408-22807430 GCCCGGGTGGGAAAAGGCGCTGG - Intergenic
1165460181 19:35939724-35939746 CCGCAGGTCGGCGAAGGCGCCGG - Exonic
1168645306 19:58055610-58055632 CTGCGCCTGAGAGAAGGCTCAGG - Intergenic
926092256 2:10058591-10058613 CCGCGTTGGGGAGGAGGCGCCGG + Exonic
929966816 2:46542763-46542785 CCGGGCCGGGGAGAGGGCGCGGG + Exonic
932316340 2:70786444-70786466 CCGGGCGTGGTGGCAGGCGCCGG - Intronic
937917374 2:127105803-127105825 CAGCGGGTGGGAGAGGGGGCAGG + Intronic
939423559 2:142004701-142004723 CTGGGCGTGGTAGAAGGTGCCGG + Intronic
940306554 2:152233258-152233280 CCGGGCGTGGTGGCAGGCGCCGG + Intergenic
944715240 2:202371177-202371199 CCGGGCGTGGCGGCAGGCGCCGG - Intergenic
948884876 2:240877516-240877538 CCCTGTGTGGGAGATGGCGCTGG - Exonic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1171567772 20:26209669-26209691 CCCCGCGAGGCAGAAGGCGGGGG + Intergenic
1172594497 20:36141038-36141060 CAGCAGCTGGGAGAAGGCGCTGG + Intronic
1172752355 20:37259619-37259641 CAGCCCTTGGGAGAAGGGGCAGG - Intronic
1173800434 20:45891444-45891466 TCGCGGGTGGGAGCTGGCGCTGG + Intronic
1175167350 20:57054295-57054317 CCGAATGTGGGAGAAGGCGCTGG - Intergenic
1175522317 20:59609656-59609678 CTGGGCGTGGGAGAGGGCGGAGG + Intronic
1177521448 21:22233011-22233033 CCTCACGTGGCAGAAGGCGAAGG - Intergenic
1178417076 21:32412696-32412718 CCGCGCAGGGGAGGAGGCTCTGG + Exonic
1179150687 21:38806025-38806047 CCGGGCGAGGGCGAGGGCGCCGG - Exonic
1183401336 22:37606692-37606714 CCGGGCGTGGTGGCAGGCGCCGG + Intergenic
1183975320 22:41508703-41508725 CCGAGCCTGGGAGAAGGAGCAGG - Intronic
1185149901 22:49158310-49158332 CATCGGGTGGTAGAAGGCGCAGG + Intergenic
952316702 3:32238489-32238511 CGGCGCGGAGGAGAGGGCGCAGG - Intergenic
955902698 3:63774253-63774275 CCGGGCGTGGTGGCAGGCGCCGG + Intergenic
960586017 3:119322541-119322563 CGGAGCGTGGGTGGAGGCGCTGG - Intronic
961439986 3:126947018-126947040 CCACACGTGTGAGCAGGCGCTGG + Intronic
964571052 3:158107165-158107187 GCGCGGGTCGGAGAAGGTGCAGG - Intronic
964720372 3:159763812-159763834 CGGCGGGTGGGAGGAGGGGCCGG + Intronic
965669416 3:171131193-171131215 CCGGGCGTGGTAGCGGGCGCCGG + Intronic
968224899 3:196967414-196967436 CCGCTTATGGGAGAAGGCGGCGG + Intronic
968613886 4:1568778-1568800 GCGCGGGTGGGAGGCGGCGCGGG - Intergenic
975622498 4:76308124-76308146 CTGGGCGTGGTAGTAGGCGCCGG + Intronic
979534431 4:121803680-121803702 CCGGGCGTGGTGGCAGGCGCCGG - Intronic
985663327 5:1168397-1168419 CCACGCGTGGGAAAGGGCACAGG - Intergenic
985688415 5:1294211-1294233 CCCCGGGTGCGAGGAGGCGCGGG - Exonic
986186776 5:5449651-5449673 CAGGGAGTGGGAGAAGGAGCAGG + Intronic
990410311 5:55534950-55534972 CCGCCTGTGGGAGAGAGCGCCGG - Exonic
992627468 5:78648601-78648623 CCGCGCCTGGAAGAAGGAGGCGG + Exonic
994199331 5:96954923-96954945 CCGGGCGTGGTGGCAGGCGCCGG - Intronic
997282260 5:132656507-132656529 CCGCGCGTGGGAGAAGGCGCTGG - Intronic
997899965 5:137754869-137754891 CCCTGGGCGGGAGAAGGCGCGGG - Intergenic
998526998 5:142851716-142851738 CAGCACGTGGGAGAAAGGGCAGG - Intronic
1002638378 5:180619181-180619203 CCGCGGGCGGGAGGGGGCGCGGG - Intronic
1003113050 6:3264927-3264949 CTGCGTGTGGGAGAAGGCTCAGG + Intronic
1003318784 6:5034604-5034626 CCGCTCATGGCAGAAGGCGCAGG - Intergenic
1007652996 6:43434662-43434684 CTGCGGGTGGGAGCAGGCACTGG + Exonic
1013330446 6:109095004-109095026 CTGGGCGGGGAAGAAGGCGCTGG - Intergenic
1016400799 6:143678017-143678039 CCGCGCGGGGTAGAAGGTGAGGG + Exonic
1018652734 6:166005521-166005543 CCACGCGTGGGTGCAGGCACCGG + Intergenic
1019358200 7:591910-591932 CCGTGCGTGGGAGCCGGGGCTGG - Intronic
1019474380 7:1236846-1236868 CCGGGCCTGGGCGACGGCGCGGG - Exonic
1020058112 7:5132573-5132595 CTGCGCCTGGGAGAGGGCGGGGG - Intergenic
1025087324 7:56034016-56034038 CCGAGCGTCGGAGCCGGCGCTGG - Exonic
1025128439 7:56363451-56363473 CCCCCCGTGGGAGAAGGCTTGGG - Intergenic
1029221702 7:98995375-98995397 GCGCCGGTGGGAGATGGCGCCGG + Intronic
1029710851 7:102299040-102299062 CCGGGCGTGGGGGCAGGCACAGG - Intronic
1029813936 7:103075045-103075067 CCTCGCCTGGGAGAAGCCGCCGG + Exonic
1031406738 7:121395982-121396004 CCGGACGTTGGAGAGGGCGCAGG - Intronic
1032080418 7:128855945-128855967 AGGCGCGTGGGAGAAGGAGGTGG - Intronic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1039731355 8:40282170-40282192 CCGGGCGTGGTGGCAGGCGCGGG - Intergenic
1041464541 8:58145713-58145735 CCGCGCGTCGGCGCAGGCGGGGG + Intronic
1041686934 8:60652587-60652609 CCGCGCGTGAGAACCGGCGCGGG + Intergenic
1045861314 8:106817687-106817709 CCACCCTTGGGAGAAGTCGCTGG - Intergenic
1049566993 8:143345476-143345498 CCGCGCGTGGCAGCAGGAGCTGG - Intronic
1049681614 8:143921165-143921187 CCGTGAGTGGCAGAAGGCACAGG + Exonic
1049708236 8:144052443-144052465 CCGCACCTGGGAGGCGGCGCAGG + Exonic
1056765110 9:89440292-89440314 GCGTGGGTGGGAGAAGGCACAGG - Intronic
1057694718 9:97314972-97314994 CAGCCCATGGGAGAAGGGGCAGG + Intronic
1058410950 9:104730999-104731021 CCGGGCGTGGTAGCGGGCGCCGG + Intergenic
1058687286 9:107489820-107489842 CGGGGCATGGGAGAAGGCGGAGG - Intronic
1185750966 X:2609357-2609379 CAGCGCGCGGGCGAAGGCGGCGG - Intergenic
1185877657 X:3713461-3713483 CCCCGAGTGGGAGCAGCCGCCGG + Exonic
1186573022 X:10736119-10736141 CCGGGCGTGGTGGCAGGCGCCGG - Intronic
1188527732 X:31104606-31104628 CCAGGCGTGGTAGCAGGCGCTGG - Intronic
1190712755 X:53081783-53081805 GCGGGGGTGGGAGAAGGGGCAGG + Intergenic
1195308408 X:103608016-103608038 CCGCGAGCCGGAGAAGGCACAGG + Intronic