ID: 997283240

View in Genome Browser
Species Human (GRCh38)
Location 5:132661562-132661584
Sequence TTACCTCAGATGAGGCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997283240_997283243 -9 Left 997283240 5:132661562-132661584 CCTCAGAGCCTCATCTGAGGTAA No data
Right 997283243 5:132661576-132661598 CTGAGGTAAAGGAGCAAAGTTGG No data
997283240_997283246 -2 Left 997283240 5:132661562-132661584 CCTCAGAGCCTCATCTGAGGTAA No data
Right 997283246 5:132661583-132661605 AAAGGAGCAAAGTTGGGATTGGG No data
997283240_997283247 -1 Left 997283240 5:132661562-132661584 CCTCAGAGCCTCATCTGAGGTAA No data
Right 997283247 5:132661584-132661606 AAGGAGCAAAGTTGGGATTGGGG No data
997283240_997283245 -3 Left 997283240 5:132661562-132661584 CCTCAGAGCCTCATCTGAGGTAA No data
Right 997283245 5:132661582-132661604 TAAAGGAGCAAAGTTGGGATTGG No data
997283240_997283244 -8 Left 997283240 5:132661562-132661584 CCTCAGAGCCTCATCTGAGGTAA No data
Right 997283244 5:132661577-132661599 TGAGGTAAAGGAGCAAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997283240 Original CRISPR TTACCTCAGATGAGGCTCTG AGG (reversed) Intergenic
No off target data available for this crispr