ID: 997284071

View in Genome Browser
Species Human (GRCh38)
Location 5:132665812-132665834
Sequence CCACCCGTGAGTGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997284071_997284087 27 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284087 5:132665862-132665884 AAGGGCAGCAGGAGCCCAGCAGG No data
997284071_997284082 3 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284082 5:132665838-132665860 TCGGGCTGGAGCAGAGGCCACGG No data
997284071_997284084 9 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284084 5:132665844-132665866 TGGAGCAGAGGCCACGGCAAGGG No data
997284071_997284083 8 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284083 5:132665843-132665865 CTGGAGCAGAGGCCACGGCAAGG No data
997284071_997284085 16 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284085 5:132665851-132665873 GAGGCCACGGCAAGGGCAGCAGG No data
997284071_997284079 -3 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284079 5:132665832-132665854 TGGCCCTCGGGCTGGAGCAGAGG No data
997284071_997284088 28 Left 997284071 5:132665812-132665834 CCCTTCCCAGCACTCACGGGTGG No data
Right 997284088 5:132665863-132665885 AGGGCAGCAGGAGCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997284071 Original CRISPR CCACCCGTGAGTGCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr