ID: 997286125

View in Genome Browser
Species Human (GRCh38)
Location 5:132679916-132679938
Sequence GCCGGCCGCGTGGCTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997286117_997286125 24 Left 997286117 5:132679869-132679891 CCTCTGGGGCCTGGCGGGCTTGG 0: 1
1: 1
2: 6
3: 38
4: 303
Right 997286125 5:132679916-132679938 GCCGGCCGCGTGGCTCCTGGTGG 0: 1
1: 0
2: 3
3: 36
4: 182
997286119_997286125 15 Left 997286119 5:132679878-132679900 CCTGGCGGGCTTGGTAAGCTGCA 0: 1
1: 0
2: 1
3: 21
4: 133
Right 997286125 5:132679916-132679938 GCCGGCCGCGTGGCTCCTGGTGG 0: 1
1: 0
2: 3
3: 36
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997286125 Original CRISPR GCCGGCCGCGTGGCTCCTGG TGG Intronic