ID: 997287594

View in Genome Browser
Species Human (GRCh38)
Location 5:132692660-132692682
Sequence TTGTATGTATACATGCAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997287594 Original CRISPR TTGTATGTATACATGCAGCA TGG (reversed) Exonic
900272082 1:1796044-1796066 TTGTATGGGTACTTGGAGCATGG - Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
908394769 1:63715559-63715581 TTGTGTGAATACATTCAGCTAGG + Intergenic
909010461 1:70328925-70328947 TTGTATGTATACATGTATAGGGG + Intronic
911294356 1:96096217-96096239 TTGTATTTACACAGGCAGTATGG - Intergenic
911371462 1:96999430-96999452 CTGTATTTATAAATGCAGTACGG - Intergenic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
914977623 1:152380483-152380505 TGGTATGTACCCATGAAGCAGGG + Intergenic
918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG + Intergenic
922596696 1:226819389-226819411 TTGTAAGTACAATTGCAGCAGGG - Intergenic
923933277 1:238727967-238727989 TTGTAAATATACATGCCCCATGG - Intergenic
924376441 1:243414228-243414250 TTGTATGTATACATCTTACAGGG + Intronic
924865426 1:247974364-247974386 ATGTAGGTATACATGTACCATGG - Intronic
924885244 1:248208858-248208880 TTGGATGTTTAGATCCAGCAAGG + Intergenic
1063293455 10:4776370-4776392 TTTTAAGCTTACATGCAGCAAGG - Intergenic
1064435221 10:15305190-15305212 TTTTATTTATACTTGCTGCAAGG + Intronic
1068930434 10:62583619-62583641 TTTTAGGTCTACATGTAGCAAGG - Intronic
1072093902 10:92158068-92158090 TTCTATGTTTACATGCAGCCAGG - Intronic
1072375133 10:94807248-94807270 TGGTATGTATACATACACCATGG - Intronic
1072507604 10:96084382-96084404 TTAAATGTATACATGTAGCTAGG - Intergenic
1073813166 10:107174051-107174073 TTGTATGTATAGATCAATCAGGG + Intergenic
1074229390 10:111518420-111518442 TTTCAGGTATACATTCAGCAAGG - Intergenic
1076553308 10:131302689-131302711 ATATAGGTATACATGCACCATGG + Intronic
1078405771 11:11068669-11068691 GTGTATGTACACATTCAGCCAGG + Intergenic
1078481899 11:11684504-11684526 ATATATGTATACATGTAGAATGG - Intergenic
1078909900 11:15721142-15721164 TAGTGTGTATCCATGGAGCAGGG - Intergenic
1078910039 11:15722702-15722724 TAGTGTGTATCCATGGAGCAGGG - Intergenic
1078967068 11:16358100-16358122 TTTTATGTATACATTCTGCATGG - Intronic
1079634451 11:22718296-22718318 TTGTGTGTATATATGTATCATGG + Intronic
1081567975 11:44271225-44271247 TTCTTTGTATAAAGGCAGCAGGG - Intronic
1084283417 11:68115033-68115055 TTGTATGTTTACTTGAAGTATGG - Intronic
1084917933 11:72444602-72444624 TTGTAATTATACATCCAGTAAGG + Intergenic
1086306973 11:85490993-85491015 TTTTATGTATATATTCATCAGGG - Intronic
1086890442 11:92252304-92252326 TTGTGTGTCTGCATGAAGCAAGG + Intergenic
1086903002 11:92388626-92388648 TTGCATGTATATAAGCAACAGGG + Intronic
1088968393 11:114749280-114749302 GTGTATGTATATATGCATAATGG - Intergenic
1089122259 11:116145674-116145696 TGGTATGTACCCATGAAGCAGGG - Intergenic
1089264249 11:117246978-117247000 GTGTATGTATATATGCATGAGGG + Intronic
1091000867 11:131910255-131910277 GTGCATGTATGCATGCTGCAGGG + Intronic
1093218550 12:16391204-16391226 ATGTAGGTATACATGTACCACGG + Intronic
1093350641 12:18096701-18096723 ATGTATGTATACATGCATGTAGG + Intronic
1093350642 12:18096725-18096747 ATGTATGTATACATGCATGTAGG + Intronic
1093619224 12:21267080-21267102 TTGTTGGTATACATGAAGCCTGG - Exonic
1093625492 12:21341927-21341949 GTGTATGTATAAATGAGGCATGG + Intronic
1094640698 12:32272354-32272376 TTATATGTAGACATACAGCTTGG - Intronic
1095510653 12:42948257-42948279 ATGCATGCATGCATGCAGCATGG - Intergenic
1098179009 12:67825818-67825840 TCATATGTATACATGTAGCAAGG - Intergenic
1098622181 12:72615020-72615042 ATATATGTGTGCATGCAGCAAGG + Intronic
1101794164 12:107957456-107957478 TTTTCTGTAGTCATGCAGCAAGG - Intergenic
1105620549 13:22061782-22061804 TTGTGAGTATATATACAGCATGG + Intergenic
1105718664 13:23092391-23092413 TTGGATGTATACGTGCAGTATGG + Intergenic
1108464827 13:50705088-50705110 TTGGATGTGTACATGATGCATGG - Intronic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1108688698 13:52844535-52844557 ATGTGTGAAGACATGCAGCATGG + Exonic
1111155661 13:84320425-84320447 TTGTATAATTACATGCAGGATGG - Intergenic
1111292410 13:86186434-86186456 TGGTATGTACCCATGAAGCAGGG - Intergenic
1114729631 14:24978164-24978186 TTGTATGTCTGAATTCAGCATGG + Intronic
1116303805 14:43222082-43222104 TTTTAGATATACATGCAGAAGGG + Intergenic
1117492652 14:56266865-56266887 TTTAATGTATAGATGCAGCATGG - Intronic
1118448353 14:65872841-65872863 TTGTTTACATAGATGCAGCAAGG + Intergenic
1118515227 14:66521060-66521082 TGGTTTGTATACATACATCATGG - Intronic
1120264169 14:82228055-82228077 GTGTATAAATACATACAGCATGG - Intergenic
1120744924 14:88144309-88144331 TAGTATGTACCCATGAAGCAGGG - Intergenic
1124123318 15:26911360-26911382 GTGTGTGTGTGCATGCAGCAAGG - Intronic
1125167674 15:36727882-36727904 TTGTATCTACACATGTACCAGGG - Intronic
1128129447 15:65215890-65215912 TAGTATATATACAGGAAGCAGGG - Intergenic
1129622293 15:77159277-77159299 TTGCCTGTCTGCATGCAGCAGGG + Intronic
1131807520 15:96137901-96137923 TTATATGTATACATTCTACATGG - Intergenic
1139048578 16:63095042-63095064 TTGTATGTCTAAAAGGAGCATGG - Intergenic
1139331161 16:66191611-66191633 ATGTATGTATACATGAGGAATGG - Intergenic
1144456234 17:15421079-15421101 AGGTATGTATACATGTACCATGG - Intergenic
1147014332 17:37478790-37478812 TTGTAAATATGCATGCAGCTGGG + Exonic
1148317349 17:46714055-46714077 TTATATGTATACATGTACAAAGG - Intronic
1149010349 17:51850205-51850227 TTCTATGAAAATATGCAGCATGG + Intronic
1149361201 17:55897701-55897723 GTGAATGCATACATGCAGAAAGG - Intergenic
1153195035 18:2585524-2585546 TTGTATGGATACTTGAAGGATGG + Intronic
1153383181 18:4460976-4460998 TTGTATATATTTATGGAGCATGG + Intergenic
1156095481 18:33526324-33526346 ATGTATGTATACACACACCATGG - Intergenic
1164097811 19:22027491-22027513 TTTTCTGTATCCATGCAGGAGGG + Intergenic
1164200776 19:23016507-23016529 TTTTCTGTATCCATGCAGGAGGG + Intergenic
1164439225 19:28259357-28259379 TAGAATGTATGCATGCATCATGG - Intergenic
1164640529 19:29822033-29822055 CTGCATGTATACATTCAGCCAGG - Exonic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1167839270 19:52100752-52100774 TTCTATGTATGCATGAAGAAAGG - Intergenic
925946984 2:8874422-8874444 TTGTAATTATAAATGAAGCAAGG + Intronic
928819586 2:35343667-35343689 TGGTATGTACCCATGAAGCAGGG - Intergenic
929905076 2:46038418-46038440 GGGTAAGTAAACATGCAGCAGGG - Intronic
930008155 2:46914574-46914596 TTAAATGTATAAATGCAGCATGG - Intronic
932397281 2:71456631-71456653 ATGAATGTATACATGCACAAAGG - Intronic
933141228 2:78794461-78794483 TGGTATGTACCCATGAAGCAGGG + Intergenic
933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG + Intergenic
937748337 2:125442535-125442557 CAGTTTGTATACTTGCAGCACGG - Intergenic
938999810 2:136721287-136721309 TTGTATGTTTACTTTCAGGATGG - Intergenic
943292319 2:186089899-186089921 TTGTATTTGTACATCCATCAAGG + Intergenic
943945838 2:194062592-194062614 TTGTAACTGTAGATGCAGCATGG + Intergenic
944846603 2:203674575-203674597 TTGTATATCTACATCCAGTAGGG - Intergenic
945415581 2:209567104-209567126 TTGTATGTAGTGCTGCAGCATGG - Intronic
945491629 2:210462630-210462652 TTGTATTAATATATTCAGCATGG - Intronic
945564413 2:211378762-211378784 TTATATGTTTACATGGGGCAAGG + Exonic
945816623 2:214612799-214612821 CTGTATGAATACTTGAAGCACGG - Intergenic
1168780206 20:482770-482792 TTATATATATACACACAGCAAGG + Exonic
1169623517 20:7536679-7536701 TTGTATGTATACATGCTTTTTGG - Intergenic
1169676587 20:8161269-8161291 ATGTATGTATATATGTAGCACGG - Intronic
1170421121 20:16194313-16194335 TTGTGTTTCTACAAGCAGCAAGG + Intergenic
1172019991 20:31907386-31907408 ATGTGTGTATCCATGCATCATGG - Intronic
1173026158 20:39309484-39309506 TTGTGTGGCTACATTCAGCAGGG + Intergenic
1174770238 20:53292695-53292717 CTGTTAGTACACATGCAGCATGG - Intronic
1175914742 20:62420488-62420510 TTGTGTGTATACATGCTGTGTGG - Intronic
1177664677 21:24139521-24139543 TAGTTTGTATAGCTGCAGCAGGG + Intergenic
1177853599 21:26377317-26377339 TTTTGTGTCTACATGCAACATGG - Intergenic
1178179948 21:30148370-30148392 TTGGAAGTATACATGGATCAAGG + Intergenic
1179917686 21:44488344-44488366 TGGTATGTACCCATGAAGCAGGG - Intergenic
1181503091 22:23330900-23330922 TTGTATGTAGATATGCAACCTGG + Intergenic
1181653898 22:24279276-24279298 TTGTATGTAGATATGCAACCTGG + Intronic
1184404998 22:44295606-44295628 TTGTATGGAAACATTCAACAAGG + Intronic
1184659055 22:45957232-45957254 ATGTATGTAAAAATGCATCAAGG + Intronic
949593478 3:5518350-5518372 TGGTATATATACATACACCATGG + Intergenic
950704308 3:14770454-14770476 TTGTTTGTATAGATCAAGCAAGG - Intronic
950986767 3:17379721-17379743 GTGTATGTATAAAAACAGCATGG - Intronic
957699603 3:83691351-83691373 ATGTAGGTATACATGCGTCATGG - Intergenic
957788614 3:84912627-84912649 TTGGATGTATTCATGAGGCATGG + Intergenic
957876495 3:86153841-86153863 TTGAATGTTTACATGCAGTTTGG + Intergenic
958632525 3:96701416-96701438 CGGTATGTACCCATGCAGCAAGG - Intergenic
959144720 3:102531074-102531096 TTATATGGCTACATGCAACAAGG - Intergenic
959434052 3:106291284-106291306 ATGTATGCATATATGCAGCAAGG - Intergenic
959461824 3:106636329-106636351 TTGTATGGATACTTGAAGTATGG - Intergenic
961802435 3:129462137-129462159 TTGTATAAATACATGGAGAAAGG + Intronic
962380196 3:134892410-134892432 TGGGATGCATACTTGCAGCAGGG + Intronic
963654714 3:148031921-148031943 ATGTATGTATAAATCCACCACGG - Intergenic
965176622 3:165343468-165343490 TTGTATGTATTCAAGCAATATGG + Intergenic
965752749 3:171993420-171993442 TTATATATATACATGCACTATGG - Intergenic
968225834 3:196971372-196971394 TTGTATGTATACATCCCACAAGG + Intergenic
970094742 4:12450203-12450225 TTGTATGAATCCATGCATCCAGG - Intergenic
970335788 4:15040446-15040468 TGCTTTGTTTACATGCAGCAAGG + Exonic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
973006496 4:45014018-45014040 TTGAATGAATACATGAGGCAAGG - Intergenic
973998870 4:56489710-56489732 ATGCATGTACACATACAGCAAGG - Intronic
974469957 4:62306156-62306178 TTGTATGTATAGATACAACATGG - Intergenic
975248232 4:72145159-72145181 TTGTGTGTATATATTCAGGAAGG - Intronic
976415095 4:84763477-84763499 ATGTATGTATACATGTGCCATGG - Intronic
977455072 4:97248640-97248662 TTGAATTAATACATACAGCAAGG - Intronic
978637851 4:110831705-110831727 CTGTATGTTTACATGCATCTAGG - Intergenic
978660447 4:111119981-111120003 ATGTATGTATACATGTGCCATGG - Intergenic
980580663 4:134746069-134746091 ATATATGTATACATACACCATGG + Intergenic
980716722 4:136637954-136637976 TGGTATGTACCCATGAAGCAGGG - Intergenic
981571065 4:146151078-146151100 TTGTATGGATACTTGAAGTATGG - Intergenic
981874973 4:149531037-149531059 TTGAATATATACATGAAGTATGG - Intergenic
982230777 4:153206462-153206484 TTGAATGAATACATACAGCCAGG + Intronic
982575312 4:157102125-157102147 TTGTATGTATACATACAGTGTGG + Intronic
982786944 4:159547257-159547279 GTGTATGTATACAAGGAACATGG + Intergenic
983124110 4:163929239-163929261 TTGTTTGAATATGTGCAGCAAGG - Intronic
983711646 4:170724081-170724103 TTGTATGTGTACATGTAGGAGGG + Intergenic
984209396 4:176826876-176826898 AGGTATGTATGCATGCTGCATGG - Intergenic
987452975 5:18109088-18109110 CTGTATGTATACATGCATATGGG + Intergenic
989563465 5:42877144-42877166 TTGTATACATGCATGCAGAAAGG + Intronic
991317235 5:65322445-65322467 CTGTAAATTTACATGCAGCATGG + Intronic
993858749 5:93108184-93108206 TTATATGTATCCATGCATCTTGG + Intergenic
994057804 5:95438932-95438954 TTATATGTATAGAGGAAGCATGG + Intronic
994491663 5:100453793-100453815 GTGTGTGCATACATGCAGCAGGG - Intergenic
995740549 5:115351661-115351683 TTGCATGTATGCATCCAGAATGG + Intergenic
997287594 5:132692660-132692682 TTGTATGTATACATGCAGCATGG - Exonic
998525979 5:142843674-142843696 TTGTATGAAGACATGGGGCACGG + Intronic
999213547 5:149912389-149912411 ATGTCTGTAAACATGCAGAATGG - Intronic
1000810943 5:165860271-165860293 GTGGATGAATATATGCAGCAGGG + Intergenic
1002019143 5:176351038-176351060 TTGTATTTAGAAATGCAACATGG + Intronic
1004781023 6:18908867-18908889 TTGAATGAATAAATGCAGTAAGG + Intergenic
1004834919 6:19519978-19520000 TTGTAAGAATACATGTAGCCTGG - Intergenic
1005855392 6:29858217-29858239 TGCTATGTATTCATCCAGCAAGG + Intergenic
1006178726 6:32140377-32140399 TTATATGCCTACATGCAGTATGG + Intergenic
1006938678 6:37736847-37736869 ATGTATGTGAAAATGCAGCATGG + Intergenic
1007528293 6:42516350-42516372 ATGTATGTATACACGCACCATGG + Intergenic
1007629009 6:43262515-43262537 TTGTTTGTATTCCTGGAGCACGG + Intronic
1008168777 6:48175825-48175847 TTGTATGGATACTTGAAGTATGG + Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1011513134 6:88123456-88123478 TAGGATGTATACAGGAAGCACGG + Intergenic
1012063400 6:94515283-94515305 TTTTACGTAAACATTCAGCAGGG - Intergenic
1013181843 6:107723423-107723445 TTGTATAGATACTTGAAGCATGG + Intronic
1014850593 6:126335826-126335848 TGGTATGTGTACTTACAGCATGG - Intergenic
1019116460 6:169767522-169767544 CTGTGTGTGTATATGCAGCATGG - Intronic
1024264771 7:47598185-47598207 TGGTACGTATCCATGAAGCAGGG - Intergenic
1028294965 7:89117315-89117337 TTTTCTGTATACATGATGCATGG - Intronic
1029928488 7:104344622-104344644 TGGCATATATACATACAGCATGG - Intronic
1030180086 7:106697712-106697734 TTGAATGTATACAAGCACCTTGG + Intergenic
1031150786 7:118051761-118051783 TTGTCAGGATACATTCAGCAGGG - Intergenic
1031971850 7:128070322-128070344 GTGCATGTACACAAGCAGCATGG - Intronic
1034276801 7:149827402-149827424 GTGAATGCAGACATGCAGCATGG + Intergenic
1036392477 8:8336069-8336091 TTGCATGAATACATGTACCAGGG - Intronic
1036555465 8:9855813-9855835 TTGCCTGGACACATGCAGCAGGG - Intergenic
1036989286 8:13574158-13574180 GTGTATATATACATGCTGAAAGG - Intergenic
1038750782 8:30293833-30293855 TTGTATATATACATATACCATGG + Intergenic
1039007930 8:33061508-33061530 TTATATGTGCACATGCATCAAGG - Intergenic
1039708714 8:40033807-40033829 TGGGATGTCTACATGCAGGACGG + Intergenic
1041546199 8:59046133-59046155 TTGAATGAAAACATGCAACATGG - Intronic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1041934913 8:63323657-63323679 TGGTATGTACCCATGAAGCAGGG + Intergenic
1042075455 8:64988895-64988917 ATGGTTGTATACATGCACCAAGG - Intergenic
1045828766 8:106432694-106432716 TTGTATGTATGCATGCATGTAGG + Intronic
1048590834 8:135819110-135819132 TTGCATGTTTACATGTAGCTGGG - Intergenic
1052195873 9:25714121-25714143 TTGTTTGTATACTTGCAAGAAGG - Intergenic
1055820947 9:80263072-80263094 TGGAAAGTATACATGCAGTAAGG + Intergenic
1057066100 9:92053402-92053424 TTTTATGTATATATCTAGCAGGG - Intronic
1058071876 9:100609703-100609725 TTGTATCTATAGGTTCAGCAAGG - Intergenic
1058764719 9:108170490-108170512 TTGTATGGATACTTGAAGGATGG - Intergenic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1189264671 X:39704985-39705007 TTGGATATATATATACAGCATGG - Intergenic
1189303143 X:39967313-39967335 TTGCATGTTTAAATGCAGCTGGG + Intergenic
1190511642 X:51179150-51179172 ATATATGTATATATGTAGCAGGG + Intergenic
1193766714 X:85537796-85537818 TTTTATGTATATATGCAGTGTGG - Intergenic
1194696483 X:97058094-97058116 TTATATGTATTGATGCAACATGG + Intronic
1195713514 X:107795488-107795510 TTGTATGGGTACCTGAAGCATGG - Intergenic
1195909812 X:109877640-109877662 ATGTATGTATACAAGAAGCTAGG + Intergenic
1196223640 X:113139973-113139995 TTGTATTAATATATGCAGCCCGG - Intergenic
1197632139 X:128873599-128873621 ATGTATGCATACATCCAGCCTGG + Intergenic
1198003928 X:132471782-132471804 TTGTGTGTGTACATGCTGCAGGG + Intronic
1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG + Intergenic
1201252186 Y:12070459-12070481 GCATAAGTATACATGCAGCAGGG + Intergenic