ID: 997288263

View in Genome Browser
Species Human (GRCh38)
Location 5:132699985-132700007
Sequence GTCCATGCCCCTCTTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997288254_997288263 28 Left 997288254 5:132699934-132699956 CCATAATCCTACGACCCAGAGTG 0: 1
1: 0
2: 0
3: 15
4: 107
Right 997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 99
997288256_997288263 21 Left 997288256 5:132699941-132699963 CCTACGACCCAGAGTGGTAGTGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 99
997288257_997288263 14 Left 997288257 5:132699948-132699970 CCCAGAGTGGTAGTGAAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 261
Right 997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 99
997288259_997288263 13 Left 997288259 5:132699949-132699971 CCAGAGTGGTAGTGAAAAGAGGA 0: 1
1: 0
2: 0
3: 15
4: 165
Right 997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 99
997288253_997288263 29 Left 997288253 5:132699933-132699955 CCCATAATCCTACGACCCAGAGT 0: 1
1: 0
2: 7
3: 31
4: 169
Right 997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997288263 Original CRISPR GTCCATGCCCCTCTTGTGGT GGG Intronic
900185121 1:1329281-1329303 GTCCAGGCCACTGTTGTGGCTGG - Intergenic
900596186 1:3481212-3481234 GTGCATGGCCCCCTTGTGTTGGG + Intergenic
900958707 1:5905647-5905669 TTGCATGCCCCTATTGTTGTGGG - Exonic
905465896 1:38152935-38152957 CTTCTTGGCCCTCTTGTGGTTGG + Intergenic
906660892 1:47580809-47580831 GGGCAGGCCCCTCATGTGGTGGG + Intergenic
909160136 1:72136672-72136694 GTCTTTGCCCATCTTGTGCTTGG - Intronic
911663393 1:100528174-100528196 CTCCACACCCCTCATGTGGTGGG - Intergenic
917434436 1:175005275-175005297 GTCCTTGCTCATGTTGTGGTTGG + Intronic
917764330 1:178200652-178200674 GTCCATGCACCTTTTGTTGCAGG - Intronic
923435735 1:233966088-233966110 GACCATTTCCCTCTTGTGGGTGG - Intronic
924365813 1:243292239-243292261 GTCCTTTCCCCCCTTGAGGTGGG + Intronic
1063862492 10:10326663-10326685 GGCCATGCCCCACGTGTGGATGG - Intergenic
1067732082 10:48819791-48819813 GTCGGTGCCCATCTTGTGATGGG - Intronic
1077310418 11:1886465-1886487 CTCCATGCTCCTCATGGGGTAGG - Intronic
1079887177 11:26003360-26003382 GTCCATGCCCCTTATGTGAAGGG + Intergenic
1079933707 11:26593672-26593694 GTCCATGCCCCTTATGTGAAGGG - Intronic
1083057185 11:59833907-59833929 TTCCATGCCCCTCTCAAGGTAGG - Intronic
1083293842 11:61704775-61704797 TTCCATTCCCCTCCTGTAGTAGG + Intronic
1085250758 11:75142144-75142166 GTTCAAGCCCCTCCTGTTGTAGG + Intronic
1088188124 11:107196443-107196465 GTCAATGCCCCTTTTGAAGTAGG + Intergenic
1089347152 11:117797599-117797621 GTCCATGCTCCTCCTGGGGAGGG - Intronic
1093049271 12:14487630-14487652 GTACATGCCTCTTTTGTTGTAGG + Intronic
1095288559 12:40447426-40447448 GTCCCTGCCCTTCTGGTGATTGG - Intronic
1098522263 12:71446468-71446490 GTCAATACCCCCCTTGTGGTGGG + Intronic
1100149740 12:91722252-91722274 CCCCATGCCCCACTTGTGGATGG - Intergenic
1102722936 12:115033786-115033808 CTCCGTGCCCCTTTTTTGGTGGG - Intergenic
1104768556 12:131346037-131346059 GTCCATGCCCCTCCTCAGCTGGG - Intergenic
1104967227 12:132513785-132513807 CTCCAGGCCCCTCGTGGGGTTGG - Intronic
1107927545 13:45277773-45277795 GATAATGCCCTTCTTGTGGTTGG + Intronic
1109219852 13:59629995-59630017 TTCCAGCCCCCTCTTGTGCTGGG + Intergenic
1112282474 13:98075051-98075073 GTCCATGTCCATCTTGTGTGGGG + Intergenic
1117672458 14:58122790-58122812 GTCCATGCCCCTTATGTTGAGGG + Intronic
1119406757 14:74403811-74403833 GTCCATGCCCTGCTTGGGCTGGG - Intergenic
1121833749 14:97073838-97073860 GTTCAGGCCCATCTTGTGGATGG - Intergenic
1126629410 15:50718790-50718812 GTCCATGTCCATCTTGTGCTTGG - Intronic
1127570656 15:60237856-60237878 GTCCCTGACCCTCGTGTAGTGGG + Intergenic
1129968601 15:79758109-79758131 GTCCATGCCCACCCTGTGGCTGG - Intergenic
1131853702 15:96569636-96569658 GTTCCAGCCCCTCTTGTGGCTGG + Intergenic
1132684242 16:1155639-1155661 GTCCATGCCCTGCTTGGGGATGG - Intronic
1137290553 16:47049391-47049413 GTCCATGGTCACCTTGTGGTTGG + Intergenic
1138675190 16:58646221-58646243 GTCCATCCCCAACTTGAGGTGGG + Intergenic
1141685149 16:85565874-85565896 GTCCTTGCCAGTCTTCTGGTGGG + Intergenic
1143463941 17:7123161-7123183 GTCCACGCCTCTCCTGTGGTTGG - Intergenic
1144867363 17:18345147-18345169 CTCCATGCCCATCCTGAGGTGGG + Intronic
1146270118 17:31479491-31479513 GTCCATGCCCCTGGTGTCTTTGG - Intronic
1146836114 17:36112332-36112354 GTGCATGCCCCTTTTGTTGCAGG - Intergenic
1147262471 17:39216765-39216787 GTCCCTGCTCCCATTGTGGTGGG - Intronic
1148605072 17:48922992-48923014 GTCGATGCCACGCTTGTGGGGGG - Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1161397823 19:4054183-4054205 GTCCATGACGCCCTTGTCGTCGG + Exonic
1162931624 19:13960482-13960504 GTCCACGCAGCTCTTGCGGTAGG - Exonic
1165247184 19:34504526-34504548 CTCCCTGCCCCTGTTGGGGTGGG + Exonic
1165367647 19:35378635-35378657 GTCCTTGACCCTGTTGAGGTGGG + Intergenic
1168266516 19:55226674-55226696 CTCCATGGCCCTCTGGTGGGGGG - Intronic
926137290 2:10345875-10345897 GTCCTTGCCCCTTTTGTGGTGGG - Intronic
928702096 2:33909388-33909410 TCCAATCCCCCTCTTGTGGTAGG + Intergenic
929674509 2:43912103-43912125 ATCCATGTACCTTTTGTGGTGGG - Intronic
937307126 2:120879143-120879165 GTCCCTGCCCCTCCTGGGGAAGG - Intronic
940910396 2:159205050-159205072 TTCCAGGCCCCTCTTGGGGGTGG + Intronic
941779419 2:169427748-169427770 GTCCAGAACCCTCTTGTGTTGGG + Intergenic
946863843 2:224025163-224025185 GGCCGTGCCAGTCTTGTGGTGGG - Intronic
947908821 2:233788560-233788582 GTCCTTCCTCCTCTGGTGGTAGG - Intronic
1172981984 20:38950334-38950356 ATGCCTGCCCCTATTGTGGTTGG + Intronic
1175299359 20:57932119-57932141 GTGCAGGCCGCTCTTGTGGCAGG - Intergenic
1176230943 20:64032637-64032659 GTCCATGCTCCTCAGGAGGTGGG + Intronic
1176407848 21:6431179-6431201 GGCCATGCCCGTCGTGTGCTGGG + Intergenic
1178944995 21:36939616-36939638 CTCCCTGTCCCCCTTGTGGTAGG - Intronic
1179064337 21:38010360-38010382 GTCCTTGCACCTCTTGTTGATGG + Intronic
1179683339 21:43039510-43039532 GGCCATGCCCGTCGTGTGCTGGG + Intergenic
1179716510 21:43291353-43291375 GACCATGTCCCTCCTGTGGGGGG - Intergenic
1181529256 22:23507226-23507248 ATCCATGCCCCTCTGGTGAGTGG + Intergenic
964690504 3:159444327-159444349 GTCCATGCCTCGCATGTGTTTGG - Intronic
965698836 3:171438812-171438834 GTCCAACCACCACTTGTGGTGGG + Intronic
965781117 3:172287119-172287141 GTCCATGCCCATCAAGTGGGAGG + Intronic
966494798 3:180567881-180567903 AGCCATGCCCCTCTGGTGATGGG + Intergenic
969889781 4:10249261-10249283 GTTCCTGCCCCCCTGGTGGTAGG + Intergenic
969958948 4:10922952-10922974 GCCCATCCCCCTGTTGTGGGTGG + Intergenic
976764527 4:88585313-88585335 GTACATGTCCATCTTGTAGTTGG + Intronic
981338062 4:143589064-143589086 GTCCTTGGCCCACTTGTGGATGG + Intronic
982065692 4:151652686-151652708 GTCCATGCCCCTCCTCTGTGAGG - Intronic
982107316 4:152022282-152022304 GGCCATGCCCATCATGTGGCTGG + Intergenic
985626510 5:991680-991702 GTCCCTACCCCTCCTGGGGTTGG - Intergenic
987504038 5:18747078-18747100 GTGCATGCACCTCTTGTTGCAGG - Intergenic
997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG + Intronic
997717879 5:136055711-136055733 GTACCTCCCCCTCTTGTCGTGGG - Exonic
999686124 5:154104761-154104783 GTCAATGCCCGGCATGTGGTAGG + Intronic
1001308590 5:170594386-170594408 GGCCATACCCCTCTTCTGGTGGG - Intronic
1002260856 5:177993108-177993130 GTCCCTGCACCTCTTGTCATTGG - Intronic
1005956409 6:30666505-30666527 GTCAAAGCCCCTCTGGTGGCTGG + Intronic
1006910532 6:37560605-37560627 CTCCCTGGCCCCCTTGTGGTTGG + Intergenic
1015385582 6:132619250-132619272 GCCCATGCCCTCCTTGTGTTGGG + Intronic
1017753174 6:157507764-157507786 TTCCTTGCCCCTCTTCTGGATGG + Intronic
1017977484 6:159370826-159370848 GTGCATCCACCTCTTGTTGTAGG + Intergenic
1021494765 7:21261927-21261949 CTGCCTGGCCCTCTTGTGGTGGG - Intergenic
1031236484 7:119185198-119185220 GTGCATGCCCCTTTTGTTGCAGG - Intergenic
1037841414 8:22247908-22247930 GTCCATGCCCCTCTCGTTGTCGG - Exonic
1042524820 8:69753257-69753279 GCTCCTGCCCCTCTTGGGGTAGG - Intronic
1051068808 9:13137423-13137445 GTCCTTGCCCCTCCTGGGCTGGG - Intronic
1051341971 9:16120412-16120434 GTCCATGACCCTCTCTTGCTGGG + Intergenic
1051356650 9:16245428-16245450 GTCCATGCCTTTCATGTGTTTGG - Intronic
1056278918 9:85020578-85020600 GTCCTTGCTCCTCTGGTGATGGG + Intronic
1057454163 9:95192196-95192218 GTCCCTGCTCCTCCTGTCGTTGG - Intronic
1059757154 9:117304282-117304304 GCCCAACCCCATCTTGTGGTGGG - Intronic
1060934123 9:127506003-127506025 GTCCCTGTCCCTCTGGTGGTTGG - Exonic
1061254904 9:129449341-129449363 ATCCATGCCCCTCTGGTGAGTGG - Intergenic
1061678646 9:132231847-132231869 GTCCCTGCCTCTCTTGGGGTGGG + Intronic
1062117381 9:134816727-134816749 GTCCCTGCCCAGGTTGTGGTGGG + Intronic
1189946568 X:46186758-46186780 GTCCATGCCCCTTTTGTCAAAGG + Intergenic