ID: 997300219

View in Genome Browser
Species Human (GRCh38)
Location 5:132798208-132798230
Sequence GTGCAGAAACAGGTTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997300219_997300222 4 Left 997300219 5:132798208-132798230 CCCTCTTCAACCTGTTTCTGCAC 0: 1
1: 0
2: 2
3: 30
4: 372
Right 997300222 5:132798235-132798257 TCACCCCCAATCCTCATCCCTGG 0: 1
1: 0
2: 5
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997300219 Original CRISPR GTGCAGAAACAGGTTGAAGA GGG (reversed) Intronic
900504033 1:3020356-3020378 GTGTAGACACATGTTGTAGATGG - Intergenic
900831153 1:4966600-4966622 GTGCAGGCACAGGCAGAAGAAGG + Intergenic
901264437 1:7899340-7899362 GAGCTGAAACAGGATAAAGATGG - Intergenic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902096171 1:13947761-13947783 GTGAAGATACAGGGAGAAGACGG - Intergenic
902806080 1:18862110-18862132 GTGCAGAAAGGGGGTGATGAGGG - Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903490282 1:23723123-23723145 GGGCAGAAACAGGTTTAGGGAGG + Intergenic
903494840 1:23758802-23758824 GTGTAGAAACAGGTCTAAGGTGG - Intronic
904834194 1:33324385-33324407 CTGCAGAAACAGGCTGAAGGGGG + Exonic
905115537 1:35636105-35636127 GTGAAGACACAGGGAGAAGATGG + Intronic
906869821 1:49465878-49465900 GTGGGGAGAAAGGTTGAAGAAGG + Intronic
907240680 1:53079335-53079357 CTGCAGATACAGGTTTGAGAAGG + Intronic
908061919 1:60359719-60359741 CTGCAAAAGAAGGTTGAAGAAGG - Intergenic
908414286 1:63897919-63897941 AAGAAGACACAGGTTGAAGATGG - Intronic
910458336 1:87422076-87422098 GTGAAGACCCAGGTGGAAGATGG - Intergenic
911160713 1:94680159-94680181 CTGCAGCACCATGTTGAAGACGG + Intergenic
912895265 1:113579831-113579853 GTGGAGGAACAGGTTTGAGAAGG + Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
914315631 1:146508861-146508883 GTGAAGACCCAGGTGGAAGATGG - Intergenic
914498724 1:148224500-148224522 GTGAAGACCCAGGTGGAAGATGG + Intergenic
916524670 1:165598369-165598391 GTGCAGAAACAGGACGGAGAAGG + Intergenic
916741561 1:167651011-167651033 GTGAAGACACAGGGAGAAGATGG - Intronic
917082172 1:171267537-171267559 GTACAGGAACATGTTGAAGAAGG + Exonic
917582696 1:176395659-176395681 GTGCAGAAAGAGGTAGACGTGGG - Intergenic
917644141 1:177013340-177013362 GTTCTGGAACAGGTTGAAGTTGG - Intronic
918221118 1:182437333-182437355 GAGTAGAAACATGTTGAAAAAGG + Intergenic
918923308 1:190744768-190744790 GTGAAGACACAGGGAGAAGATGG - Intergenic
919131337 1:193454730-193454752 GTGCAGAGTGAGGTTGAATAGGG + Intergenic
921310828 1:213841642-213841664 GTGCAGAAACATGTCTATGAGGG - Intergenic
921458717 1:215403760-215403782 GTGAAGATACAGGAAGAAGATGG - Intergenic
922014457 1:221630987-221631009 GTGCAGAAAGTGTTTCAAGATGG + Intergenic
923008430 1:230069868-230069890 GTGCAGAAACTGGCTAAATATGG - Intronic
923064199 1:230503268-230503290 GTGAAGACACAGGGAGAAGACGG + Intergenic
923072497 1:230578304-230578326 GTACAGAAACAGGGTGCAAAAGG - Intergenic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923441856 1:234028195-234028217 GTGCAAACAGAGGTGGAAGATGG - Intronic
923578586 1:235185419-235185441 GTGCAGAGATAGGATGAATAAGG - Intronic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
1062932306 10:1361267-1361289 GTGTAGAAACAGGGTGAAAAAGG + Intronic
1063340805 10:5261716-5261738 GTGCAGACACAGGGAGAAAAGGG + Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063559128 10:7110204-7110226 GTGAGGACACAGGTAGAAGATGG - Intergenic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1064980104 10:21157913-21157935 GTGAAGACACAGGGAGAAGACGG + Intronic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1067364254 10:45610422-45610444 GTGTAGAAACAGGTTGTAAAGGG + Intergenic
1067795423 10:49317927-49317949 GTGAAGACACAGGGAGAAGACGG + Intronic
1068075213 10:52245212-52245234 CTACAGAAACAGTTTGAAAAAGG - Intronic
1069093815 10:64234041-64234063 GTGAAGATACAGGGAGAAGATGG + Intergenic
1069630586 10:69894946-69894968 GCCCAGAAAGAGGCTGAAGAGGG - Intronic
1070444666 10:76485002-76485024 ATACAGAAACAGGTTGAAAATGG - Intronic
1071337679 10:84614171-84614193 GCGAAGATACAGGGTGAAGACGG - Intergenic
1072177889 10:92946897-92946919 GTTCAGAAACAGGACAAAGAAGG - Intronic
1072260488 10:93665863-93665885 GTGAAGACACAGGGAGAAGATGG - Exonic
1072612068 10:97024152-97024174 GCCCAGAAACAGGTGGAAAATGG - Intronic
1075382049 10:122027497-122027519 GTGCAGAAACAGTTTAATGGAGG - Intronic
1075678257 10:124312815-124312837 GTGAAGACACAGGGAGAAGATGG - Intergenic
1075827737 10:125374242-125374264 GTGCAGACACTGGGAGAAGACGG - Intergenic
1076151086 10:128162390-128162412 GGGCAGAAAAAGGAAGAAGAAGG + Intergenic
1077025740 11:439115-439137 GTGCAGACACAGGAAGAAGGTGG + Intronic
1077122916 11:918722-918744 GTGCAGACCCAGGGAGAAGATGG + Intergenic
1079072242 11:17357285-17357307 GTGAAGACACAGGGAGAAGATGG - Intronic
1079284109 11:19113940-19113962 GTGAAGACACAGGGAGAAGATGG + Intergenic
1080279540 11:30540743-30540765 GTGCAGAACTAGGATTAAGAAGG - Intronic
1080659837 11:34286709-34286731 GAGCAGAAACAGCATGAAAATGG - Intronic
1080688265 11:34533987-34534009 GTGAAGACACAGGGAGAAGATGG + Intergenic
1080881131 11:36321849-36321871 GTGAAGACACAGGGAGAAGATGG - Intronic
1081108681 11:39104743-39104765 GTGAAGACACAGGAGGAAGATGG - Intergenic
1082011305 11:47451310-47451332 GTGAAGACACAGGGAGAAGATGG + Intergenic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083059672 11:59856712-59856734 GTGGAAAAACAGGCTGGAGAAGG + Intronic
1084517763 11:69645702-69645724 AGTCAGAAACAGGTTGAAGGAGG + Intronic
1084747502 11:71182551-71182573 GTGAAGACACAGGGAGAAGATGG - Intronic
1084864827 11:72047017-72047039 GTTCAGATAGAGGTTGAAGCGGG + Intronic
1085252819 11:75154765-75154787 GTGCCAAAACAGCCTGAAGACGG + Intronic
1085811388 11:79685303-79685325 GTGAGGAAACAGGCTGAAGAAGG + Intergenic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1086427974 11:86705609-86705631 GAGGAGAAACATGTTGCAGAGGG - Intergenic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1087760090 11:102096417-102096439 GTGAAGAAACCGGAAGAAGATGG + Intergenic
1088115866 11:106312273-106312295 GTGAAGACACAGGGCGAAGACGG + Intergenic
1088246369 11:107821862-107821884 GTGGACAAACAGGTAGAAGATGG + Intronic
1091971219 12:4788533-4788555 GAGGAGGAATAGGTTGAAGAAGG + Intronic
1093068407 12:14683321-14683343 ATGCTGAAACAGGTTAAAGAGGG - Intronic
1093078859 12:14786805-14786827 GGGAAGAAACAGGGTGAAAATGG + Exonic
1093253560 12:16838080-16838102 GTGCAGAAACATGTTACTGAGGG - Intergenic
1095279609 12:40334875-40334897 GTGCATCAACAGGCTGAACATGG - Intronic
1097138155 12:56876676-56876698 GAGCACAAGAAGGTTGAAGAGGG - Intergenic
1097233839 12:57526972-57526994 GTGCTGAAGGAGGTGGAAGAAGG - Exonic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1098454489 12:70656796-70656818 GTGCAGGAATAGGTAGAACAGGG - Exonic
1099014992 12:77333668-77333690 GTCCAGAACCAGGCTTAAGAAGG - Intergenic
1099754919 12:86833515-86833537 GTGAAGACACAGGGAGAAGACGG - Intronic
1101071633 12:101081812-101081834 GTGAAGACACAGGGAGAAGATGG - Intronic
1101582736 12:106058101-106058123 GTGAAGAAACAGATTGAAAGAGG - Intergenic
1101735400 12:107459514-107459536 CTGCAGACACAGTTTTAAGAAGG + Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102820200 12:115902051-115902073 GTGCAGAAAGATGTAGGAGAGGG + Intergenic
1103459082 12:121089589-121089611 TTCCAGAAGCAGGTGGAAGATGG + Intergenic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104685713 12:130782772-130782794 GTGAAAAAAAAGGTTCAAGAAGG - Intergenic
1105273216 13:18897487-18897509 GTACAGTAACTGGTTGAAAATGG + Intergenic
1105289669 13:19044130-19044152 GTGCAGAAAAATTATGAAGATGG + Intergenic
1105823997 13:24105874-24105896 GTGAAGACACAGGGTGAAGACGG + Intronic
1105864698 13:24449017-24449039 CTGATGAAACAGTTTGAAGATGG + Intronic
1106398340 13:29403333-29403355 GTGCAGATACAGGGTGGACAGGG - Intronic
1106549851 13:30761730-30761752 GTGAAGACACAGGTAGAAGGTGG - Intronic
1107721926 13:43258388-43258410 GTGGTGAAACAGCTGGAAGAAGG + Intronic
1109157692 13:58931105-58931127 GTGAAGAGACAGGAAGAAGATGG + Intergenic
1110646424 13:77890595-77890617 GTCAAGAAACCTGTTGAAGAGGG + Intergenic
1110986356 13:81974848-81974870 GTACAGAAAGAAGTTGAAGGGGG - Intergenic
1111070018 13:83153561-83153583 GGGGAGAAACAGTTTGAATATGG + Intergenic
1111962742 13:94829217-94829239 GTGCAGCTACAGGTTGCAGCTGG + Intergenic
1112073131 13:95876630-95876652 GTGCTGTATCAGGTTGAGGAAGG + Intronic
1112204365 13:97309472-97309494 GTGAAGAGACAGGAAGAAGATGG + Intronic
1114888323 14:26883258-26883280 GTGAAGACACAGGGAGAAGATGG + Intergenic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1116229008 14:42192057-42192079 TGGCACAAACAGTTTGAAGAAGG - Intergenic
1116975900 14:51115713-51115735 GTGAAGACACAGGGAGAAGATGG - Intergenic
1118032105 14:61828095-61828117 GTGAAGACACAGGAAGAAGATGG + Intergenic
1119165045 14:72485666-72485688 TTGCAGAACCAGGTTCAAGCTGG - Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1120016796 14:79483002-79483024 GTGCACACACAGCTTGAAAAAGG - Intronic
1120772334 14:88393997-88394019 GTACAGAAACAGGTGGTAGGAGG - Intronic
1122017219 14:98806304-98806326 GTGCAGACACAGTTTGCACATGG - Intergenic
1124212584 15:27775757-27775779 GTGAAGACACAGGGAGAAGACGG - Intronic
1124626350 15:31309601-31309623 GTGCGGTAACAGGAGGAAGACGG - Intergenic
1124633083 15:31348262-31348284 GTGCAAAACCAAGCTGAAGAGGG - Intronic
1125120936 15:36157991-36158013 GTTCAGGAACAGGTTAATGAGGG - Intergenic
1125847773 15:42873914-42873936 GTGGAGAAAGAGGTAGAACATGG - Intronic
1125880454 15:43189531-43189553 GTGTTAAAACGGGTTGAAGAGGG - Intronic
1125906375 15:43396716-43396738 GAGAAGAAAGAGGTAGAAGATGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1130768195 15:86894790-86894812 GTGCTCAAACAAGTTAAAGAAGG + Intronic
1131071714 15:89470359-89470381 TTCCAGAAACAGGTTGTAAAGGG + Intergenic
1132153497 15:99478625-99478647 GTGCAGACACGGGGAGAAGATGG - Intergenic
1132405856 15:101541564-101541586 GTGCTGAGTCAGGTGGAAGAGGG - Intergenic
1133678298 16:8096581-8096603 GTTCAGCAGCAGGTAGAAGAAGG + Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1134376498 16:13680244-13680266 GAGCAGTAAGGGGTTGAAGATGG - Intergenic
1134813792 16:17189242-17189264 GGGAAGATTCAGGTTGAAGATGG - Intronic
1135462307 16:22655393-22655415 GTGAAGACACAGGGAGAAGATGG + Intergenic
1135842680 16:25891000-25891022 GGTCAGAAACAGCTTCAAGAAGG + Intronic
1138225454 16:55290742-55290764 GTGCTGGAGGAGGTTGAAGATGG + Intergenic
1139192793 16:64884198-64884220 GTGCAGACACAGGGAGAAGATGG - Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1143462381 17:7112261-7112283 GTGCTGAGACAAGTGGAAGATGG + Intronic
1143771949 17:9174574-9174596 GTGAAGACACAGGGAGAAGACGG - Intronic
1143883968 17:10052414-10052436 GGGGAGAAACAGGTCTAAGAGGG + Intronic
1144045873 17:11454181-11454203 GTGCAGAAATAGATTGAATATGG - Intronic
1144110437 17:12026203-12026225 GTGCTGAAACTTGTTTAAGATGG + Intronic
1144630800 17:16871203-16871225 GCGGAGGAACGGGTTGAAGAGGG + Intergenic
1144650515 17:17004246-17004268 GTGGAGGAATGGGTTGAAGAGGG - Intergenic
1146664066 17:34685198-34685220 GTGCAGAAAGAAGTCCAAGAAGG - Intergenic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147510302 17:41062999-41063021 GTGCAGCATCAGGTAAAAGAAGG - Intergenic
1147836053 17:43332640-43332662 GTGGAAAAATAGGTTGAATATGG + Intergenic
1148159720 17:45443032-45443054 GTGCAGAAACAGGTGGTGGTGGG + Intronic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1149440391 17:56669073-56669095 GTGAAGATACAGGGAGAAGACGG - Intergenic
1151355294 17:73554489-73554511 GTGAAGACACAGGGAGAAGATGG + Intronic
1151536259 17:74740597-74740619 GAGGAGAGACAGGGTGAAGATGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153689348 18:7575946-7575968 GTGGAGAATCTGATTGAAGATGG + Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1156200121 18:34821400-34821422 GTGCAGGGGAAGGTTGAAGAGGG + Intronic
1156521750 18:37727736-37727758 GTGCAGACACAGACAGAAGATGG - Intergenic
1158074270 18:53510796-53510818 GTGATGAAAGAGGTAGAAGAAGG - Intronic
1158091130 18:53715005-53715027 GTGGAGATACAGGGAGAAGAGGG - Intergenic
1158184830 18:54759943-54759965 TTGCAGGAACAAATTGAAGATGG - Intronic
1165651357 19:37493568-37493590 GTGCAGAAAGAGGTTAAATAAGG + Intergenic
1166843808 19:45714021-45714043 GAGCAGACAGAGGTTGCAGAGGG + Intronic
1166883352 19:45942358-45942380 GTGAAGACACAGGGAGAAGAAGG + Intronic
1168235572 19:55061078-55061100 GTGAGGATGCAGGTTGAAGATGG - Intronic
925316190 2:2926074-2926096 GTGAAGACACAGGAAGAAGATGG + Intergenic
927737023 2:25533481-25533503 GTGCAGAAACGGTTTTAATAGGG - Intronic
929047778 2:37806759-37806781 GTGAAGACACAGGGAGAAGATGG + Intergenic
929247053 2:39713568-39713590 GTGAAGACACAGGGAGAAGATGG + Intronic
931184989 2:59941133-59941155 GAGCAGAGACAGGTTGAAAAAGG - Intergenic
931243077 2:60469595-60469617 GTGCAGTAAAATGGTGAAGATGG - Intronic
933207290 2:79521787-79521809 ATGCAGAAACAGGTGACAGAGGG + Intronic
933291359 2:80441986-80442008 GTGCAGAAAGATGCAGAAGAAGG - Intronic
934602148 2:95665840-95665862 GTACAGAAACAGGCAGAGGAGGG - Intergenic
935529847 2:104218969-104218991 GTGAAGACACAGGGAGAAGATGG - Intergenic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936535505 2:113307995-113308017 GTTCAGAAACAGGCAGAGGAGGG - Intergenic
937086657 2:119176307-119176329 GTGAAGACACAGGGAGAAGAGGG - Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
938920857 2:135993318-135993340 GTGAAGACACAGGGAGAAGAGGG + Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940637536 2:156317815-156317837 GGGCAGAAGCAGGTGGCAGACGG - Intergenic
940912354 2:159219769-159219791 GTCCAGTATCTGGTTGAAGAAGG + Exonic
941166365 2:162087351-162087373 GTGCAGATACAGGATGATTAAGG - Intergenic
942312979 2:174672730-174672752 CTGCAGGAACAGGGAGAAGATGG - Intronic
942706729 2:178782302-178782324 GTCCAGAAACTGGTGGAAGGTGG - Exonic
942877478 2:180818692-180818714 GTGCAAAAACAGATCAAAGAAGG - Intergenic
944832421 2:203546184-203546206 GTGAAGACACAGGGAGAAGACGG - Intergenic
947181428 2:227414820-227414842 GTGAAGACACAGGGAGAAGATGG + Intergenic
947562645 2:231170856-231170878 ATGCAGAAAAAGGTTGAAACGGG - Intronic
947860134 2:233352769-233352791 GTGAAGACACAGGGAGAAGATGG - Intergenic
948166503 2:235866778-235866800 GTGAAGACACAGGGAGAAGATGG - Intronic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
948670467 2:239565188-239565210 GTGCAGAGAAGGGATGAAGAAGG + Intergenic
1168876983 20:1178548-1178570 GATCAGAAACAGGTTTAAGGAGG - Intronic
1169326602 20:4681794-4681816 GGGCAGAAGCAAATTGAAGAGGG - Intergenic
1169349670 20:4858077-4858099 GTGCAGTGACTGGTTGATGAAGG - Intronic
1169571519 20:6911742-6911764 GTGCAGACCCAGCTTGTAGATGG + Intergenic
1170276294 20:14594180-14594202 GTGAAGAACCAGGTTGAAGAGGG - Intronic
1172497463 20:35398431-35398453 GAGTAGAAACAGGTTGAGGTGGG + Intronic
1173386582 20:42593935-42593957 GTTCAGAGAGAGGTTGAAGCTGG + Intronic
1173470754 20:43321637-43321659 GTGAAGACACAGGGAGAAGATGG - Intergenic
1174548588 20:51344809-51344831 GTGCAGGAAGAGGTGGGAGAAGG - Intergenic
1176707655 21:10127522-10127544 GTGGACAAACAGGATCAAGATGG - Intergenic
1178232259 21:30799652-30799674 TTGCAGAGACAGATTCAAGAAGG + Intergenic
1178441785 21:32604267-32604289 TTGCAGAAACAAGTGGAAGCCGG - Exonic
1178709005 21:34897751-34897773 AAGCAGAAACTGGTTGTAGAAGG + Intronic
1179261273 21:39760114-39760136 GTGCACACACAGGTTGATAATGG - Intronic
1179302464 21:40124654-40124676 GTGAAGACACAGGGAGAAGAGGG + Intronic
1181334863 22:22121243-22121265 GTACAGTAACTGGTTGAAAATGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182852032 22:33483524-33483546 GTGAAGAGGCAGGTTAAAGATGG + Intronic
1184997013 22:48214667-48214689 GTGCAGAAACAGGCTGGAAGTGG + Intergenic
949211387 3:1506594-1506616 GTGCAGAATTATGTTGAAAAAGG + Intergenic
950208348 3:11097080-11097102 GTGTTGAAACAGGTTGCAGGAGG - Intergenic
950933017 3:16809910-16809932 GTTCAATAACAGGTTTAAGATGG - Intronic
952215892 3:31277994-31278016 GTGAAGACACAGGGAGAAGATGG - Intergenic
952388715 3:32861602-32861624 GTGCAAAAGCAGGTGAAAGAGGG - Intronic
955854112 3:63254912-63254934 GTGAAGACACAGGGAGAAGATGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956142740 3:66162132-66162154 GTGAAGACACAGGGAGAAGATGG - Intronic
956185155 3:66555445-66555467 TTGCAGAAACCCCTTGAAGAAGG - Intergenic
956752366 3:72353489-72353511 GTGAAGATACAGGGAGAAGATGG + Intergenic
956904895 3:73755731-73755753 GTCCAGAAGCAGGTGGGAGAAGG - Intergenic
957828186 3:85478622-85478644 TTGCAGAAACAAGTTTAATAAGG + Intronic
960348520 3:116564989-116565011 GTGCTGAAACAGGCTGAAATGGG - Intronic
960851538 3:122059876-122059898 GTGAAGACACAGGGCGAAGACGG + Intronic
960920668 3:122744561-122744583 ATACAGAAAGATGTTGAAGAAGG + Intronic
961580283 3:127875243-127875265 GTGAAGACACAGGGAGAAGATGG - Intergenic
961851165 3:129820240-129820262 GTGAAGAAACAAGATGAAGTTGG - Intronic
962073849 3:132059592-132059614 GTGAAGACACAGGGAGAAGATGG - Intronic
962431493 3:135324524-135324546 GGGGAGAAACAGGGTGGAGAAGG + Intergenic
962941139 3:140125760-140125782 GTGCAGAATCTGGCTGAAAAGGG + Intronic
964650436 3:159005510-159005532 GTTCACAAAAAGGTTGAATATGG + Intronic
965364043 3:167776650-167776672 GTGCAGACACAGCTAGAAGTAGG - Intronic
965613161 3:170565814-170565836 ATGAAGAAACAAGTGGAAGAGGG + Intronic
965894914 3:173563859-173563881 GTGTAGAAACTGGTTGTAGAGGG - Intronic
966274346 3:178146726-178146748 GTGTGGAAACAGGTTGGAAAGGG - Intergenic
967252677 3:187558929-187558951 GTGGAGATAGAGGTTGATGATGG - Intergenic
969125725 4:4946418-4946440 GTGAAGACACAGGGAGAAGACGG + Intergenic
969673216 4:8601180-8601202 GTGCTGAAGCAGGTTGGGGAAGG - Exonic
970291121 4:14573375-14573397 GTGAAGACACAGGAGGAAGATGG + Intergenic
971193830 4:24453115-24453137 GTGAAGATACAGGGAGAAGATGG + Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
974033221 4:56794859-56794881 GTGCAGACTCAGGGAGAAGATGG + Intergenic
977988476 4:103414341-103414363 GAGCAGAAATATCTTGAAGAAGG - Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978289742 4:107123767-107123789 GTTCAGACAAAGGTTGAACATGG + Intronic
979324049 4:119358291-119358313 TTGAAGAAATAGGTTTAAGAAGG + Intergenic
979565265 4:122147593-122147615 GTGAAGACACAGGAAGAAGATGG + Intergenic
980094249 4:128473188-128473210 GAAGAGAAACAGATTGAAGATGG + Intergenic
981444434 4:144819309-144819331 GTGAAGACACAGGAAGAAGACGG - Intergenic
981659565 4:147149369-147149391 GAGCCTAAGCAGGTTGAAGATGG - Intergenic
981856152 4:149295355-149295377 GTGAAGACACAGGGAGAAGATGG + Intergenic
981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG + Intronic
983886084 4:172982158-172982180 ATGCAGAAAGAAATTGAAGAAGG - Intronic
983962464 4:173771129-173771151 GTCCAGGAATAGGTTGAAGAGGG + Intergenic
984674554 4:182531859-182531881 GTGCATAAACAGTTTAAACATGG + Intronic
985585146 5:727772-727794 ATGCAAAAATAAGTTGAAGATGG + Intronic
985598649 5:812087-812109 ATGCAAAAATAAGTTGAAGATGG + Intronic
986751479 5:10791850-10791872 GTGAAGACACAGGGAGAAGACGG + Intergenic
987222541 5:15805030-15805052 GTGAAGACACAGGGAGAAGATGG - Intronic
987466061 5:18273344-18273366 GTGAAGACTCAGGGTGAAGATGG - Intergenic
987933080 5:24427629-24427651 GTGCAGAAAGGGGTTGGAGGGGG - Intergenic
989254889 5:39355820-39355842 GTGAAGACACAGGGAGAAGATGG - Intronic
990715369 5:58630595-58630617 ATACAGCAACAGGTTGAATAAGG - Intronic
991335884 5:65546735-65546757 GTGAAGACACAGGAAGAAGATGG + Intronic
992464434 5:76989858-76989880 GAGCAAAAAAAGGTGGAAGAAGG - Intergenic
992883806 5:81137671-81137693 GTGAAGACACAGGAAGAAGACGG + Intronic
993164646 5:84336620-84336642 GAGGAGAAAGAGGTTGAAGAAGG + Intronic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994036601 5:95208922-95208944 GAGAAGAAACAGATTAAAGAAGG - Intronic
995696520 5:114883998-114884020 GTCCAGAGACTGGTTGATGAGGG + Intergenic
996263269 5:121500884-121500906 GTGAAGACACAGGGAGAAGATGG + Intergenic
996509118 5:124299295-124299317 GTGAAGACACAGGGAGAAGATGG - Intergenic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
996998083 5:129723883-129723905 ATACAGAAACAACTTGAAGAGGG + Intronic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
998181994 5:139952398-139952420 GGGCAGAAACAAGGTGCAGAGGG + Intronic
998652836 5:144140814-144140836 GTGAAGACACAGGGAGAAGATGG + Intergenic
998999576 5:147905785-147905807 GTTAATAAACAGGTTGCAGAGGG - Intronic
999572102 5:152930699-152930721 GTGAAGAAAAAGCTTGAAGGAGG + Intergenic
1000518769 5:162273935-162273957 GTGAAGAAATGGCTTGAAGAAGG - Intergenic
1000615414 5:163420421-163420443 GTTCAAAAACAGCATGAAGAAGG + Intergenic
1001406874 5:171482709-171482731 GTTCAGAAACAGATTGACCAAGG - Intergenic
1001525497 5:172425780-172425802 GTGTGGAAACGGCTTGAAGAGGG + Intronic
1001852615 5:174982732-174982754 GTGAAGACACAGGGAGAAGATGG - Intergenic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1003456416 6:6286800-6286822 GAGAAGAAAGAGGGTGAAGAGGG + Intronic
1005363360 6:25053604-25053626 TTGCACAAACAAGTTGAAGATGG + Intergenic
1006375654 6:33670462-33670484 GTGCAGCATCAGGTGGCAGAAGG - Exonic
1006926962 6:37661852-37661874 GTGCAGGAACAGATTGAAGGGGG + Intronic
1007703193 6:43776148-43776170 ATGCTGAAACAGGCTGAAAAAGG - Intronic
1007937027 6:45741578-45741600 GGGCAGAAACAGGAGGGAGAGGG - Intergenic
1008552086 6:52642825-52642847 GAGCAGAAAACTGTTGAAGATGG + Intergenic
1008633071 6:53382337-53382359 GGGAAGAAACAGGATGAAAATGG - Intergenic
1008874980 6:56315704-56315726 GTGCAAAAACAGGTAGAGGAGGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1010273323 6:73939693-73939715 GTGAAGACACAGGGAGAAGATGG + Intergenic
1013362204 6:109404384-109404406 CTGCAGCAACACGTTGCAGATGG - Intronic
1013364843 6:109429265-109429287 GTGCAGAAGCAGGCTGGAGTAGG - Intronic
1014143161 6:117966698-117966720 GTGAAGACACAGGGAGAAGATGG - Intronic
1015554103 6:134443192-134443214 GTGGAGAGAGAAGTTGAAGAGGG + Intergenic
1016034762 6:139374281-139374303 GTGCAACAACAGGATGAGGAGGG - Intronic
1016235886 6:141865744-141865766 TTGCAGAAACAGGATGAAGCTGG + Intergenic
1016582213 6:145641365-145641387 GTGAAGATACAGGGAGAAGATGG + Intronic
1016852634 6:148636561-148636583 GTGAAGACACAGGGGGAAGATGG + Intergenic
1017918066 6:158848006-158848028 GTGAAGACACAGGCAGAAGACGG + Intergenic
1018457979 6:163969812-163969834 GTGCAGAAGCAGGTACTAGAAGG - Intergenic
1018655690 6:166033805-166033827 CTGCAGAGAGAGGTTTAAGAGGG + Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1024049437 7:45609489-45609511 GCGCGGAAACAGGCTGAAGAGGG - Intronic
1024103582 7:46058734-46058756 GTGAAGATACAGGCAGAAGATGG + Intergenic
1025283997 7:57648169-57648191 ATCCAGAAATAGGTTGGAGAGGG + Intergenic
1027986085 7:85292124-85292146 GTGAAGACACAGGGAGAAGATGG + Intergenic
1028172523 7:87615551-87615573 GGGCAGAAACAGCTGGAAGCTGG + Intronic
1028654171 7:93183943-93183965 GTGAAGCAACAGGTTTAAAAGGG - Intergenic
1030680108 7:112425407-112425429 TGGCACAAACAGGTAGAAGAAGG + Intronic
1031357773 7:120809009-120809031 GTGAAGACACAGGGAGAAGATGG + Intronic
1031526307 7:122825111-122825133 GTGCAGTAACTGGATGAGGAGGG + Intronic
1031648610 7:124258113-124258135 ATGCAGAAAAAGGTAGAAGGAGG - Intergenic
1032602083 7:133308427-133308449 GTGAAGACACAGGGAGAAGATGG + Intronic
1034293522 7:149950662-149950684 GTGGAGAGACAGGTAGCAGAAGG + Intergenic
1034812544 7:154146191-154146213 GTGGAGAGACAGGTAGCAGAAGG - Intronic
1035091250 7:156313440-156313462 AAGCAGAAACAGTTTGAAAAGGG - Intergenic
1038120575 8:24609754-24609776 GTGAAGATACAGGGAGAAGATGG + Intergenic
1039504555 8:38042580-38042602 GTGCAGATACAGGGAGAAGGTGG - Intronic
1039594157 8:38776207-38776229 GTGGACAAAAACGTTGAAGAAGG - Intronic
1039852784 8:41384760-41384782 GTTCAGATACAGGTTGATGATGG - Intergenic
1041439935 8:57883509-57883531 GTGAAGACACAGGGAGAAGATGG + Intergenic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1041588941 8:59553681-59553703 GTGCAAAAACAAGCTGCAGAAGG - Intergenic
1041723143 8:60994169-60994191 GTGAAGATACAGGGAGAAGATGG - Intergenic
1042210301 8:66373479-66373501 GTGAAGATACAGGGTAAAGAAGG + Intergenic
1044086869 8:87953193-87953215 GTGCCTAACCAGGTTGCAGAAGG - Intergenic
1044742795 8:95344710-95344732 GAGCAAAATCAAGTTGAAGATGG + Intergenic
1045487242 8:102640992-102641014 GTGAAGACACAGGGAGAAGATGG + Intergenic
1045660550 8:104433063-104433085 GTGAAGACACAGGAAGAAGATGG + Intronic
1046199557 8:110906250-110906272 TTGCAGAAACACTTTGAAGATGG - Intergenic
1046363938 8:113200632-113200654 GTGCAGAACGAGCTAGAAGAAGG + Intronic
1048148090 8:131865127-131865149 GTGAAGACACAGGGAGAAGACGG + Intergenic
1048440981 8:134458749-134458771 GGGCAGAAGCCTGTTGAAGAGGG - Intergenic
1048636541 8:136301880-136301902 GTGCAAAAACAGATAGGAGAGGG - Intergenic
1048862324 8:138733064-138733086 GTGCAGAAACCCCTTGAAGTGGG - Intronic
1050668503 9:7968826-7968848 TTGCAAAAACAGGTTGAACTTGG - Intergenic
1051588090 9:18748128-18748150 GGACAGAAACAGGGAGAAGAAGG + Intronic
1051705949 9:19879922-19879944 GTTAAGAACCAGGTTTAAGAGGG - Intergenic
1051940412 9:22499085-22499107 GTGCAGAAAAAGTTTTAATATGG + Intergenic
1053100158 9:35364913-35364935 TTGCAGCAACAGGTAGAAAATGG - Intronic
1053532286 9:38894652-38894674 GTGAAGACACAGGGAGAAGACGG + Intergenic
1053761133 9:41350592-41350614 GTGGACAAACAGGATCAAGATGG + Intergenic
1054204511 9:62119061-62119083 GTGAAGACACAGGGAGAAGACGG + Intergenic
1054325870 9:63712139-63712161 GTGGACAAACAGGATCAAGATGG - Intergenic
1054633851 9:67469303-67469325 GTGAAGACACAGGGAGAAGACGG - Intergenic
1055327793 9:75150118-75150140 GTGAAGGAACTGGTTGAAGGTGG + Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1056857198 9:90141815-90141837 GTGCAGAAAAGGGGAGAAGAGGG - Intergenic
1057151650 9:92801202-92801224 GTGAAGACACAGGGGGAAGATGG - Intergenic
1058726534 9:107810072-107810094 GTGAAAAGACAGGTTGGAGAAGG + Intergenic
1058933797 9:109748851-109748873 GTGAAGACACAGGGAGAAGATGG - Intronic
1059147597 9:111914903-111914925 GAACAGAAATAGGTTGAGGAAGG + Intronic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1059783313 9:117552780-117552802 GTGCAGAAGCAGTTTGAATCTGG - Intergenic
1060398336 9:123332094-123332116 TGGCAGAAGCAGGTTCAAGATGG + Intergenic
1060831438 9:126720113-126720135 GTCCAGAAACAGGCTGGAGTCGG + Intergenic
1062083666 9:134637560-134637582 TGGCAGACACAGGCTGAAGAAGG + Intergenic
1202792400 9_KI270719v1_random:96402-96424 GTGGACAAACAGGATCAAGATGG - Intergenic
1185800661 X:3007613-3007635 GTGAAGACACAGGGAGAAGACGG - Intronic
1186044142 X:5516071-5516093 GTGAAGACACAGGGAGAAGAAGG - Intergenic
1186781722 X:12918834-12918856 GTGCTAAAAGAAGTTGAAGATGG - Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189409604 X:40758355-40758377 GGGCAGAAACAGTTGGAAGGGGG + Intergenic
1191978410 X:66899282-66899304 GTGTGGAAGCATGTTGAAGAAGG + Intergenic
1192757648 X:74063437-74063459 GTGAAGGCACAGGGTGAAGATGG - Intergenic
1195038059 X:100988179-100988201 GTGGAGAAGCTGGTGGAAGATGG - Exonic
1195246286 X:102998542-102998564 GTGCTGAACCAGGTGGAAGGGGG - Intergenic
1195345902 X:103951064-103951086 GTGAAGACACAGGGAGAAGATGG - Intronic
1195361703 X:104088450-104088472 GTGAAGACACAGGGAGAAGATGG + Intergenic
1195959512 X:110371193-110371215 GTACACAAAGAGGATGAAGAAGG - Intronic
1196322238 X:114355122-114355144 GGGGAGAAGCAGGTTGAAAAGGG - Intergenic
1196902825 X:120402752-120402774 GTACAAAAAGAGGATGAAGAAGG - Intergenic
1197985297 X:132260264-132260286 GTGAAGGCACTGGTTGAAGATGG + Intergenic
1198256859 X:134931641-134931663 GTGAAGACACAGGATGAAGGTGG + Intergenic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199045902 X:143171561-143171583 GTAAAGTAAAAGGTTGAAGAGGG + Intergenic
1199819534 X:151430982-151431004 GTGAACACACAGGTAGAAGATGG + Intergenic
1200872142 Y:8113033-8113055 GTGGAGAATGAGGTTGAAGGTGG + Intergenic
1201231405 Y:11868233-11868255 GTGAAGACACAGGGAGAAGATGG + Intergenic
1201402388 Y:13617436-13617458 GTGCAGAAACAGTTGCAAAAGGG - Intergenic
1202101005 Y:21307389-21307411 GTGGAGAATGAGGTTGAAGGTGG + Intergenic
1202243835 Y:22796014-22796036 GTGGAGAATGAGGTTGAAGGTGG - Intergenic
1202396822 Y:24429764-24429786 GTGGAGAATGAGGTTGAAGGTGG - Intergenic
1202473961 Y:25240328-25240350 GTGGAGAATGAGGTTGAAGGTGG + Intergenic