ID: 997301277

View in Genome Browser
Species Human (GRCh38)
Location 5:132807483-132807505
Sequence TCCAGGGACTTGAGGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997301277_997301283 -8 Left 997301277 5:132807483-132807505 CCCATCCCCCTCAAGTCCCTGGA No data
Right 997301283 5:132807498-132807520 TCCCTGGAGCTCCTGCCTCCTGG No data
997301277_997301287 -2 Left 997301277 5:132807483-132807505 CCCATCCCCCTCAAGTCCCTGGA No data
Right 997301287 5:132807504-132807526 GAGCTCCTGCCTCCTGGGACCGG No data
997301277_997301285 -7 Left 997301277 5:132807483-132807505 CCCATCCCCCTCAAGTCCCTGGA No data
Right 997301285 5:132807499-132807521 CCCTGGAGCTCCTGCCTCCTGGG No data
997301277_997301288 1 Left 997301277 5:132807483-132807505 CCCATCCCCCTCAAGTCCCTGGA No data
Right 997301288 5:132807507-132807529 CTCCTGCCTCCTGGGACCGGAGG No data
997301277_997301293 30 Left 997301277 5:132807483-132807505 CCCATCCCCCTCAAGTCCCTGGA No data
Right 997301293 5:132807536-132807558 TCTTTACAGATGAGATGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997301277 Original CRISPR TCCAGGGACTTGAGGGGGAT GGG (reversed) Intergenic
No off target data available for this crispr