ID: 997302182

View in Genome Browser
Species Human (GRCh38)
Location 5:132814023-132814045
Sequence GTGGCTCTGTTGGCAGACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302182_997302187 -9 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302187 5:132814037-132814059 CAGAGCCACAGGACACCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 197
997302182_997302204 30 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302182_997302188 -8 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302188 5:132814038-132814060 AGAGCCACAGGACACCCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 141
997302182_997302190 -6 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302190 5:132814040-132814062 AGCCACAGGACACCCCGGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 200
997302182_997302192 -2 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302192 5:132814044-132814066 ACAGGACACCCCGGGGGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 200
997302182_997302198 23 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302198 5:132814069-132814091 TCCGAGCCCGCTCAGCCGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 97
997302182_997302186 -10 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302186 5:132814036-132814058 ACAGAGCCACAGGACACCCCGGG 0: 1
1: 0
2: 3
3: 24
4: 275
997302182_997302200 24 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302200 5:132814070-132814092 CCGAGCCCGCTCAGCCGCCCGGG 0: 1
1: 0
2: 3
3: 15
4: 213
997302182_997302189 -7 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302189 5:132814039-132814061 GAGCCACAGGACACCCCGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 157
997302182_997302201 25 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302182 Original CRISPR GTGGCTCTGTTGGCAGACCC AGG (reversed) Exonic