ID: 997302191

View in Genome Browser
Species Human (GRCh38)
Location 5:132814042-132814064
Sequence GGCCCCCCCGGGGTGTCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302191_997302198 4 Left 997302191 5:132814042-132814064 CCACAGGACACCCCGGGGGGGCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302198 5:132814069-132814091 TCCGAGCCCGCTCAGCCGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 97
997302191_997302204 11 Left 997302191 5:132814042-132814064 CCACAGGACACCCCGGGGGGGCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302191_997302201 6 Left 997302191 5:132814042-132814064 CCACAGGACACCCCGGGGGGGCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
997302191_997302200 5 Left 997302191 5:132814042-132814064 CCACAGGACACCCCGGGGGGGCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302200 5:132814070-132814092 CCGAGCCCGCTCAGCCGCCCGGG 0: 1
1: 0
2: 3
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302191 Original CRISPR GGCCCCCCCGGGGTGTCCTG TGG (reversed) Exonic