ID: 997302194

View in Genome Browser
Species Human (GRCh38)
Location 5:132814053-132814075
Sequence GCTCGGAGGCCGGCCCCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302194_997302198 -7 Left 997302194 5:132814053-132814075 CCCGGGGGGGCCGGCCTCCGAGC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 997302198 5:132814069-132814091 TCCGAGCCCGCTCAGCCGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 97
997302194_997302200 -6 Left 997302194 5:132814053-132814075 CCCGGGGGGGCCGGCCTCCGAGC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 997302200 5:132814070-132814092 CCGAGCCCGCTCAGCCGCCCGGG 0: 1
1: 0
2: 3
3: 15
4: 213
997302194_997302204 0 Left 997302194 5:132814053-132814075 CCCGGGGGGGCCGGCCTCCGAGC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302194_997302201 -5 Left 997302194 5:132814053-132814075 CCCGGGGGGGCCGGCCTCCGAGC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302194 Original CRISPR GCTCGGAGGCCGGCCCCCCC GGG (reversed) Exonic