ID: 997302196

View in Genome Browser
Species Human (GRCh38)
Location 5:132814063-132814085
Sequence GGCTGAGCGGGCTCGGAGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302196_997302213 30 Left 997302196 5:132814063-132814085 CCGGCCTCCGAGCCCGCTCAGCC 0: 1
1: 0
2: 0
3: 22
4: 320
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302196_997302204 -10 Left 997302196 5:132814063-132814085 CCGGCCTCCGAGCCCGCTCAGCC 0: 1
1: 0
2: 0
3: 22
4: 320
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302196 Original CRISPR GGCTGAGCGGGCTCGGAGGC CGG (reversed) Exonic