ID: 997302201

View in Genome Browser
Species Human (GRCh38)
Location 5:132814071-132814093
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302191_997302201 6 Left 997302191 5:132814042-132814064 CCACAGGACACCCCGGGGGGGCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
997302184_997302201 15 Left 997302184 5:132814033-132814055 CCAACAGAGCCACAGGACACCCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
997302195_997302201 -6 Left 997302195 5:132814054-132814076 CCGGGGGGGCCGGCCTCCGAGCC 0: 1
1: 0
2: 2
3: 22
4: 225
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
997302182_997302201 25 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
997302193_997302201 -4 Left 997302193 5:132814052-132814074 CCCCGGGGGGGCCGGCCTCCGAG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
997302194_997302201 -5 Left 997302194 5:132814053-132814075 CCCGGGGGGGCCGGCCTCCGAGC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 997302201 5:132814071-132814093 CGAGCCCGCTCAGCCGCCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type