ID: 997302204

View in Genome Browser
Species Human (GRCh38)
Location 5:132814076-132814098
Sequence CCGCTCAGCCGCCCGGGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302196_997302204 -10 Left 997302196 5:132814063-132814085 CCGGCCTCCGAGCCCGCTCAGCC 0: 1
1: 0
2: 0
3: 22
4: 320
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302195_997302204 -1 Left 997302195 5:132814054-132814076 CCGGGGGGGCCGGCCTCCGAGCC 0: 1
1: 0
2: 2
3: 22
4: 225
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302193_997302204 1 Left 997302193 5:132814052-132814074 CCCCGGGGGGGCCGGCCTCCGAG 0: 1
1: 0
2: 1
3: 13
4: 110
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302191_997302204 11 Left 997302191 5:132814042-132814064 CCACAGGACACCCCGGGGGGGCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302184_997302204 20 Left 997302184 5:132814033-132814055 CCAACAGAGCCACAGGACACCCC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302182_997302204 30 Left 997302182 5:132814023-132814045 CCTGGGTCTGCCAACAGAGCCAC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159
997302194_997302204 0 Left 997302194 5:132814053-132814075 CCCGGGGGGGCCGGCCTCCGAGC 0: 1
1: 0
2: 0
3: 21
4: 180
Right 997302204 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302204 Original CRISPR CCGCTCAGCCGCCCGGGGAG CGG Exonic