ID: 997302213

View in Genome Browser
Species Human (GRCh38)
Location 5:132814116-132814138
Sequence TCCAGCCCTTGAGCTAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302197_997302213 26 Left 997302197 5:132814067-132814089 CCTCCGAGCCCGCTCAGCCGCCC 0: 1
1: 0
2: 1
3: 35
4: 770
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302209_997302213 -10 Left 997302209 5:132814103-132814125 CCGACCCACCGCTTCCAGCCCTT 0: 1
1: 0
2: 2
3: 26
4: 329
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302199_997302213 23 Left 997302199 5:132814070-132814092 CCGAGCCCGCTCAGCCGCCCGGG 0: 1
1: 0
2: 2
3: 19
4: 331
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302206_997302213 6 Left 997302206 5:132814087-132814109 CCCGGGGAGCGGTCCGCCGACCC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302202_997302213 18 Left 997302202 5:132814075-132814097 CCCGCTCAGCCGCCCGGGGAGCG 0: 1
1: 0
2: 1
3: 25
4: 799
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302203_997302213 17 Left 997302203 5:132814076-132814098 CCGCTCAGCCGCCCGGGGAGCGG 0: 1
1: 0
2: 0
3: 23
4: 423
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302205_997302213 9 Left 997302205 5:132814084-132814106 CCGCCCGGGGAGCGGTCCGCCGA 0: 1
1: 0
2: 0
3: 4
4: 39
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302207_997302213 5 Left 997302207 5:132814088-132814110 CCGGGGAGCGGTCCGCCGACCCA 0: 1
1: 0
2: 0
3: 5
4: 46
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302208_997302213 -7 Left 997302208 5:132814100-132814122 CCGCCGACCCACCGCTTCCAGCC 0: 1
1: 0
2: 2
3: 29
4: 287
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168
997302196_997302213 30 Left 997302196 5:132814063-132814085 CCGGCCTCCGAGCCCGCTCAGCC 0: 1
1: 0
2: 0
3: 22
4: 320
Right 997302213 5:132814116-132814138 TCCAGCCCTTGAGCTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302213 Original CRISPR TCCAGCCCTTGAGCTAGCCC AGG Exonic