ID: 997302258

View in Genome Browser
Species Human (GRCh38)
Location 5:132814275-132814297
Sequence GCTGCCGGTGCGCTGCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997302254_997302258 -3 Left 997302254 5:132814255-132814277 CCGCAGCAGAAGCCCTGTATGCT 0: 1
1: 0
2: 1
3: 12
4: 223
Right 997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 126
997302252_997302258 17 Left 997302252 5:132814235-132814257 CCGGGGCAGCGAAAGGGCCGCCG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 126
997302253_997302258 0 Left 997302253 5:132814252-132814274 CCGCCGCAGCAGAAGCCCTGTAT 0: 1
1: 0
2: 0
3: 8
4: 110
Right 997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 126
997302247_997302258 24 Left 997302247 5:132814228-132814250 CCCGGGCCCGGGGCAGCGAAAGG 0: 1
1: 0
2: 1
3: 28
4: 283
Right 997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 126
997302249_997302258 23 Left 997302249 5:132814229-132814251 CCGGGCCCGGGGCAGCGAAAGGG 0: 1
1: 0
2: 2
3: 20
4: 242
Right 997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 126
997302251_997302258 18 Left 997302251 5:132814234-132814256 CCCGGGGCAGCGAAAGGGCCGCC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997302258 Original CRISPR GCTGCCGGTGCGCTGCGTCC CGG Exonic
900129688 1:1082089-1082111 GCTGCCCTGGCGCTGAGTCCTGG - Exonic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
900694213 1:4000109-4000131 GCTGCAGCTGCTCTGAGTCCAGG + Intergenic
901109477 1:6784393-6784415 GCTGCCCTCGCGCTGCGTACGGG - Intergenic
901317397 1:8318233-8318255 CCTGCCGGGGCGCCGCGCCCTGG + Intronic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
904005854 1:27362864-27362886 GCTCCCGGTGCCCAGCATCCTGG + Exonic
904006654 1:27366553-27366575 GCTGCCGGCGCGCTCCGCCCCGG + Exonic
905028409 1:34866205-34866227 GCTGCCGGTCCACGGAGTCCAGG + Exonic
906627142 1:47334268-47334290 GCCGCCGGCGCGCGGCGTGCCGG + Intronic
907240074 1:53076331-53076353 GCTGCCGGGGAGCCGCCTCCAGG + Intronic
907460543 1:54602810-54602832 GCTGCCTGTGCGTTGGGCCCTGG + Intronic
912404596 1:109426389-109426411 GCTGCCGGTGAGTTGGGTGCCGG - Intronic
915535024 1:156530299-156530321 GCTGCTTGTGGGCTGCTTCCTGG + Exonic
917869582 1:179229558-179229580 GCAGCCGCCGCGCTGCCTCCAGG + Exonic
919916926 1:202144620-202144642 GCTGCCCTCGCGCTGCGGCCCGG + Exonic
923299786 1:232630291-232630313 GCAGCCGGTGCGCTGTTCCCAGG + Intergenic
1063196378 10:3747421-3747443 GCAGCCTCTGAGCTGCGTCCTGG - Intergenic
1063455367 10:6178846-6178868 GGGACCAGTGCGCTGCGTCCCGG - Intronic
1069636370 10:69927307-69927329 GCTGCCCGTGCCCTGGGTCATGG + Intronic
1073101916 10:101010839-101010861 GCTGCCGGTGAACGGCTTCCCGG - Intronic
1074818566 10:117163080-117163102 GCTGGCGGAGCGCAGAGTCCCGG - Intergenic
1075031990 10:119029894-119029916 GCTGCGGGTGCGCCGGGCCCGGG - Exonic
1077048486 11:556248-556270 GCAGCTGGTGCGCGGCTTCCCGG - Exonic
1077164610 11:1129447-1129469 GCGGCCGGTGAGCTGAGCCCGGG + Intergenic
1083580006 11:63818733-63818755 GCTGCAGGCGCCCTGCGCCCAGG - Intronic
1089273212 11:117315693-117315715 GCTGCCCCTGCGCAGCGGCCTGG - Exonic
1092071302 12:5633657-5633679 GGTGCCGGGGCTCTACGTCCAGG - Intronic
1094837022 12:34326848-34326870 GCAGCCCCTGCGCTGTGTCCTGG - Intergenic
1098416879 12:70243868-70243890 GCTGCCGCCGCGCTGCTTCCTGG + Intronic
1102457207 12:113078054-113078076 GCTGGTGGTGCGCTGGGGCCCGG - Exonic
1104758368 12:131282765-131282787 GCTGAGGGTGGGCTGCGGCCAGG - Intergenic
1104847579 12:131854424-131854446 GCTGGCGATGCCCTGCCTCCTGG - Intergenic
1108363839 13:49691340-49691362 GCTGGCGGCGGGCTGCGCCCTGG - Exonic
1113540124 13:111100732-111100754 GCTGCTGCTGCGCTGAGTTCAGG - Intergenic
1113840214 13:113355011-113355033 GTTGCCGGTGCGCTTCGCACCGG - Intronic
1113852837 13:113427831-113427853 GCAGCCCCTGAGCTGCGTCCAGG + Intronic
1114627934 14:24141483-24141505 GCTCCCGGCGCCCTGGGTCCCGG + Exonic
1115651377 14:35404668-35404690 GCTGCGGGTGCGCTGGGCCGCGG + Exonic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122913435 14:104844825-104844847 GCAGCCAGGGCGCTGCATCCCGG - Intergenic
1125508913 15:40282590-40282612 GCTGCCCGGGCGCGGCGGCCGGG - Intronic
1127207267 15:56733610-56733632 GCAGCCGGCGCGCTGCCTCATGG + Intronic
1129468845 15:75738946-75738968 GCTGCAGGTGCAGAGCGTCCCGG - Intergenic
1129607931 15:77033864-77033886 GCTGCGGGTGTGCTGCCTCCTGG - Intronic
1129672381 15:77614442-77614464 GCTGGAGGTGCGCTACGCCCAGG - Exonic
1129871582 15:78944948-78944970 GCTGCCGCTGCTCTGCGCCGGGG - Exonic
1130093860 15:80841686-80841708 GCTGCCGGAGCCCTCCCTCCAGG + Intronic
1132153123 15:99476132-99476154 GCTGCCCGTGCACTGGGTTCTGG - Intergenic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1144727438 17:17508870-17508892 GCTGCGGGTGAGCTGGGCCCTGG + Intronic
1147292014 17:39451148-39451170 ACTGCTGGTGCCCTGCGTCCCGG - Exonic
1147970870 17:44218785-44218807 GCGGCGGCTGCGCTGCGTCCGGG - Intronic
1151757107 17:76081375-76081397 GCAGCTGGTGCCCTGCTTCCAGG + Exonic
1152209201 17:78994155-78994177 GCTGCCTGTGAGCTGCATCAGGG + Intronic
1152753493 17:82077435-82077457 GCTGCAGGTGGGCAGTGTCCAGG - Intergenic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1160723931 19:609247-609269 GCTGCCGGGGGGCACCGTCCTGG + Intronic
1161041940 19:2114993-2115015 GATGCAGGTTGGCTGCGTCCTGG - Intronic
1161178015 19:2859309-2859331 GCTTCCGGTGTGGTGGGTCCCGG + Exonic
1161572113 19:5036369-5036391 GCTGGCGGTGCCCTGGGTGCAGG + Intronic
1163291951 19:16384763-16384785 CCTGCAGGTGCGAGGCGTCCAGG - Intronic
1164086357 19:21906221-21906243 GCTGCCTGTGCCCTGCTTTCAGG + Intergenic
1164118482 19:22244570-22244592 TCTGCCTGTGCCCTGCTTCCTGG - Intergenic
1164180652 19:22815447-22815469 GCTGCCTGTGCTCTGCTTTCAGG + Intergenic
1164227504 19:23258697-23258719 GCTGCCTGTGTGCTGCTTTCAGG - Intergenic
1167306843 19:48714542-48714564 GCTGCCGGAGCTCTGAGACCTGG + Exonic
1167683913 19:50943602-50943624 GATGCCGGTGTGCTGAGTCCTGG + Exonic
1168314069 19:55476499-55476521 GCAGGCGGTGCGCGGCATCCTGG - Exonic
925090497 2:1151294-1151316 GGTGCCGGCGGGCTGCCTCCGGG + Intronic
925725148 2:6865123-6865145 GCTGCAGGTGGGCTGCGCACAGG - Exonic
927567193 2:24123506-24123528 GCTCGCGCGGCGCTGCGTCCGGG + Exonic
927606600 2:24491614-24491636 GCTGCGGGTGCGGAGCCTCCCGG + Intergenic
927704841 2:25290752-25290774 GCTGCAGGTGGGCTGCAGCCTGG - Intronic
927714204 2:25341867-25341889 GGTGCCGCGGCGCCGCGTCCCGG + Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
929538979 2:42805121-42805143 GCTGCCAGTGGGCGGCTTCCCGG - Intergenic
929788536 2:45008423-45008445 GCTGCCGCTGGGCTGTGGCCGGG + Intronic
929933424 2:46276182-46276204 GCTGCCGGGGTCTTGCGTCCCGG - Intergenic
942346109 2:175004846-175004868 GCCGCAGGTGGGCCGCGTCCCGG - Intronic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
947877594 2:233477991-233478013 GCGGCAGGTGCTCTGCGGCCGGG + Intronic
948436094 2:237955704-237955726 GCTGCCGGTGCTCAGCCTTCAGG + Intergenic
948466870 2:238156494-238156516 TCTGCCCATGGGCTGCGTCCTGG + Intergenic
948479122 2:238239511-238239533 GCTGACGGTGCGGCGGGTCCAGG - Exonic
948826228 2:240574549-240574571 TCTGCCGGTGCAGGGCGTCCAGG - Exonic
1168799459 20:634906-634928 GATGCCAGTGCCCTGCCTCCAGG - Intergenic
1169116810 20:3071633-3071655 GGTGCGGGTGCGCTGGGTCCAGG - Exonic
1174526439 20:51175782-51175804 GCTGCCGGGGCCCTGCCCCCAGG - Intergenic
1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG + Exonic
1175910038 20:62400739-62400761 GCTGCAGCTCCTCTGCGTCCTGG - Intronic
1176062156 20:63177165-63177187 GGTGCCGCTGGGCTGCGTGCCGG + Intergenic
1176221292 20:63970300-63970322 GCTGCCGGTGCACGGCCCCCAGG - Intronic
1180614647 22:17119663-17119685 GCTGGCGCTGCGCTGCCTCCTGG - Exonic
1180744392 22:18077865-18077887 GCTTCCGGGGCGCGGCGTGCTGG + Intergenic
1182117578 22:27766004-27766026 GCGGCAGGTGCGCTTCTTCCTGG - Intronic
950253920 3:11488531-11488553 GGCGCCGCTGCGCTGCGGCCCGG - Intronic
951906953 3:27715365-27715387 GCGGCGGGTGCGCAGCGTCTGGG + Intergenic
953982125 3:47418198-47418220 GCTGCTGGTGAGCTGCTGCCTGG - Exonic
956406371 3:68932504-68932526 GCAGTCGGTGCGCCCCGTCCAGG + Exonic
960903775 3:122577689-122577711 CCTGCCGCTGCTCTGAGTCCAGG + Exonic
961361570 3:126371291-126371313 GCTTCAGGTGGGCTGCGTCGGGG + Intergenic
961393669 3:126571307-126571329 GCTGCCTGAGGGCTGCGGCCTGG + Intergenic
963939800 3:151086672-151086694 GCCACCGGAGCGGTGCGTCCCGG + Intronic
968498466 4:932049-932071 GCTGCGGGTGCGGCGGGTCCTGG - Exonic
969462495 4:7336171-7336193 GCTGCCCCTGCCCTGCGTCCTGG + Intronic
985678897 5:1245919-1245941 GCTGCCCGTGCTGTGGGTCCCGG + Exonic
992487584 5:77210859-77210881 GCAGCGGGTGCGCTGGGTCCCGG + Exonic
992611266 5:78510368-78510390 GCAGGCGGTGCTCTGGGTCCGGG - Exonic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
998337116 5:141383126-141383148 GCTGCCGCTGCGCTGGTTCAGGG - Exonic
1002091801 5:176810534-176810556 GCTGGCGCTGCGCTCCGCCCCGG + Exonic
1002697474 5:181100634-181100656 GCTGCCCCTGCGCTGCTGCCCGG + Intergenic
1006599012 6:35213709-35213731 GCTGCCGGGCCGCTGCCTGCAGG - Intergenic
1013322524 6:109009192-109009214 GCTCCCGGGGAGCAGCGTCCCGG - Intronic
1019210997 6:170404791-170404813 GCTGGCAGGGCTCTGCGTCCAGG - Exonic
1019279721 7:193592-193614 GCGGCCGGTGCGCGGGGTCGTGG - Exonic
1019363538 7:618157-618179 GCTGCCTGTGAGCTGAGTGCAGG - Intronic
1019383296 7:739606-739628 GCTGCCCGTGCGGTGCGCACAGG - Intronic
1020264423 7:6551040-6551062 GCTCTCGGTGCACCGCGTCCGGG + Exonic
1022496022 7:30853676-30853698 GCTACCTGTGCCCTGCCTCCAGG - Intronic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1028221068 7:88197430-88197452 GCTGCCGATGGGCTGCTCCCTGG + Intronic
1033670549 7:143488764-143488786 GCTGCTGGTGCCCTGCTGCCTGG - Intergenic
1034276514 7:149826231-149826253 CCTGCCGTTGCTCTGTGTCCTGG - Intergenic
1034436436 7:151064761-151064783 GGTGCAGGTGCGCTGGGTGCGGG + Exonic
1035018544 7:155787335-155787357 GCTGTCCCTGCGCTGCCTCCTGG - Intergenic
1035368949 7:158366588-158366610 GCTGCCGGGGCTCTGCGTTCGGG - Intronic
1036579001 8:10055052-10055074 GCTGCAGGTGCCCTGGGTCCCGG - Intronic
1039880843 8:41624598-41624620 GCTGCAGGTGCACTGCCTCGCGG + Exonic
1040684224 8:49851724-49851746 GGTGCCGTTGCACTGCGGCCTGG + Intergenic
1040806829 8:51405012-51405034 GCGGAGGGTGCGCTGGGTCCCGG - Intronic
1041713030 8:60910328-60910350 CCTGGCGGGGCGCTGCGGCCGGG + Intergenic
1047687065 8:127315670-127315692 GGCGCCGCTGCGCTGCGGCCCGG + Intergenic
1049194482 8:141308020-141308042 GCTGCAGGTGCCCGGCGCCCAGG + Intronic
1049555498 8:143279365-143279387 GCTCCAGGTGGTCTGCGTCCAGG - Intergenic
1050090940 9:2016238-2016260 GCTGCCAGGGGGCTGCGCCCCGG + Intronic
1052358577 9:27529683-27529705 GCCGCCGGTGCGCGAGGTCCCGG + Exonic
1057934002 9:99221678-99221700 GCTACCGGTGCGCTGTGCCGGGG - Exonic
1058885780 9:109320500-109320522 GCTGCCGCTGCGCCGCCGCCCGG + Exonic
1061152300 9:128835853-128835875 GCTGCAGGTGGGCTGGGTCCTGG - Exonic
1061481807 9:130901232-130901254 GGCGCAGGTGCGCTGCCTCCAGG + Intergenic
1061856259 9:133443433-133443455 GCGGCCAGTGCGCTGCGTGGAGG + Exonic
1062584116 9:137241422-137241444 GTTGCCGGGGCGCTGGGGCCAGG + Intronic