ID: 997303416

View in Genome Browser
Species Human (GRCh38)
Location 5:132822796-132822818
Sequence CTATGTAAGGAGAAGAGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997303406_997303416 -2 Left 997303406 5:132822775-132822797 CCCCACCCTCTCCACCTATAACT 0: 1
1: 0
2: 3
3: 28
4: 292
Right 997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 405
997303409_997303416 -7 Left 997303409 5:132822780-132822802 CCCTCTCCACCTATAACTATGTA 0: 1
1: 0
2: 0
3: 12
4: 170
Right 997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 405
997303407_997303416 -3 Left 997303407 5:132822776-132822798 CCCACCCTCTCCACCTATAACTA 0: 1
1: 0
2: 1
3: 10
4: 197
Right 997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 405
997303410_997303416 -8 Left 997303410 5:132822781-132822803 CCTCTCCACCTATAACTATGTAA 0: 1
1: 0
2: 1
3: 17
4: 335
Right 997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 405
997303408_997303416 -4 Left 997303408 5:132822777-132822799 CCACCCTCTCCACCTATAACTAT 0: 1
1: 0
2: 0
3: 23
4: 202
Right 997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997303416 Original CRISPR CTATGTAAGGAGAAGAGGGA AGG Exonic
902664145 1:17925849-17925871 CTCTGTGGGGAGAAGACGGAGGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903563465 1:24246466-24246488 CCCTGAAAGGAGGAGAGGGAAGG - Intergenic
903691733 1:25178904-25178926 CTATGCAGGCAGAAGTGGGAGGG - Intergenic
904289856 1:29478163-29478185 GTGTGTAAGGAAATGAGGGAAGG + Intergenic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
904893065 1:33793751-33793773 GTGTGGACGGAGAAGAGGGAGGG + Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905420874 1:37843122-37843144 CTATGGAAGATGAGGAGGGAGGG - Intronic
905689454 1:39932261-39932283 CTAGGTGAGGAGAAGATGGAAGG + Intergenic
907640171 1:56181077-56181099 CTATGTAGGGAGCAGAGAAATGG + Intergenic
907922743 1:58928740-58928762 CTCTGAAAAGATAAGAGGGAGGG - Intergenic
908035373 1:60046107-60046129 AGATGTAAGGAAAAGAGGAAAGG - Intronic
909945955 1:81663092-81663114 CACTGTAAGGAGCACAGGGAGGG + Intronic
910499338 1:87871507-87871529 CTATGGAAGGAGAAGATGTGTGG - Intergenic
910947192 1:92606933-92606955 AGATGGAAGGAGAGGAGGGAGGG - Intronic
911050336 1:93665543-93665565 CTATGTAAAGAGTAAAGGGAAGG - Intronic
912757415 1:112335946-112335968 CTATGTCAGTAGGAGAGGGCTGG - Intergenic
912954864 1:114148213-114148235 CTATGGGTGGAGAAGAGGGGAGG - Intronic
914801418 1:150965449-150965471 CTAGCTGAAGAGAAGAGGGAAGG + Exonic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915489419 1:156242967-156242989 ATGTGTAGGGAGAGGAGGGATGG + Intronic
917544919 1:175954948-175954970 CTATGTAAAGAGAATAGAAAAGG + Intronic
917672782 1:177288981-177289003 CTATGTTTGAAGAAGAGGCAAGG + Intergenic
918285528 1:183051016-183051038 ATTTGAAAGGAGAAGAGGAAAGG - Intronic
918664718 1:187136159-187136181 ACATGGGAGGAGAAGAGGGAGGG + Intergenic
919757628 1:201075722-201075744 CTGTGGAATGAAAAGAGGGAAGG - Intronic
920060621 1:203224740-203224762 CCATGAAATGAGAAGAGGGAGGG - Intronic
920769972 1:208874879-208874901 CTATGTAAGGAGTGCTGGGAAGG - Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924699326 1:246435156-246435178 CTATTAAAGGAGAAGAGGAAAGG + Intronic
1063558495 10:7103795-7103817 CAATGTGTGGAGATGAGGGAAGG + Intergenic
1065072722 10:22043008-22043030 CTAAGTAAGGGGAAAAGGAAAGG - Intergenic
1065313376 10:24437794-24437816 CTATGGAAGGAAAAAAGGCATGG + Intronic
1065470001 10:26068424-26068446 CGAAGTAAAGAGAAAAGGGAAGG - Intronic
1066350154 10:34630065-34630087 CTATCAAACTAGAAGAGGGAGGG + Intronic
1066594377 10:37033417-37033439 CTATGAAAAGACAAGAGGGATGG + Intergenic
1067294170 10:44965239-44965261 CTATGGAAGGAGGAGAGGCTTGG + Intronic
1067762403 10:49058121-49058143 CAATGGAAGGAGAAGCGGCAGGG - Intronic
1068629504 10:59284909-59284931 CTATGTGAGGAGAGGTGTGAAGG - Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1068947251 10:62741909-62741931 ATATGGAGGCAGAAGAGGGAGGG - Intergenic
1070389624 10:75958132-75958154 TTATGTGAGGAGGAGAAGGATGG + Intronic
1070762521 10:79033411-79033433 CTATGTGATGAGATGAGGGGAGG - Intergenic
1071437184 10:85658218-85658240 GAAAGGAAGGAGAAGAGGGAAGG - Intronic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1073421179 10:103424942-103424964 CTGTGTAAGGAAAGCAGGGATGG + Intronic
1074074958 10:110114681-110114703 CAAAGTAAGGAGAAGAGAGAAGG + Intronic
1074887061 10:117702104-117702126 CTATGTAAAGAGGAGAAGGCAGG - Intergenic
1075377373 10:121989489-121989511 GTAAGTAAGGAGGAGAGGGCTGG + Intronic
1075404049 10:122182758-122182780 CTAGATAGGGAGAAGAGTGAGGG + Intronic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1078501190 11:11879273-11879295 CTATGTGAGGTAAAGAGGGAAGG + Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1078777151 11:14404064-14404086 CTATTTAAAAAGAAGAGGGCAGG - Intergenic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080516288 11:33024066-33024088 TTATGAAAGGAAAAAAGGGAGGG + Intronic
1080753995 11:35178035-35178057 ATATGAAAGGAGCAGAGAGAGGG + Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082802375 11:57424634-57424656 CTAAGGCTGGAGAAGAGGGAGGG + Intronic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1085456043 11:76665959-76665981 CTGTGTAAGGCGGAGAGGAAAGG + Intronic
1085802515 11:79603516-79603538 CTTTGGAAGGATGAGAGGGAAGG - Intergenic
1085900568 11:80695056-80695078 CTATGTATGGAGAAGGAGGTGGG - Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089752578 11:120661862-120661884 AAATGAACGGAGAAGAGGGAGGG - Intronic
1090437582 11:126699247-126699269 CTATGTGAGGACAAGCTGGATGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091470840 12:725551-725573 CTAGGTAAGGAGATCAGGGGAGG - Intergenic
1091736014 12:2922688-2922710 CTCTGTCAGAAGAAGAGGGTGGG - Intronic
1092112501 12:5973705-5973727 CTCAGGAAGAAGAAGAGGGAGGG - Intronic
1092229505 12:6768799-6768821 ATAGGAATGGAGAAGAGGGAGGG - Intronic
1092574962 12:9772019-9772041 CCATGTGAGGAAAAGAAGGAAGG - Intergenic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1094290684 12:28845752-28845774 CTATTTAAGAGGAAGAGGAAGGG - Intergenic
1094511840 12:31101810-31101832 CTAAGGAAGGAAAGGAGGGAGGG - Intronic
1095187560 12:39218439-39218461 CTATTTAATGAGAAGGGCGATGG + Intergenic
1095374856 12:41514705-41514727 CTTTGTATGGAAAAGAGGAAAGG - Intronic
1097294753 12:57950362-57950384 CTATGCAAAGCGTAGAGGGAGGG - Intronic
1098210053 12:68153955-68153977 CTATGTATGGTGGAGTGGGAGGG - Intergenic
1098218060 12:68240617-68240639 TTAGGTAAGGAGATCAGGGAAGG - Intergenic
1098935119 12:76469993-76470015 CTATTTAAGGAAAAGAATGAGGG - Intronic
1099752212 12:86790370-86790392 GAACCTAAGGAGAAGAGGGAGGG + Intronic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100406163 12:94274475-94274497 CTTTGTTAGCAGAGGAGGGATGG + Intronic
1102647199 12:114411393-114411415 TTATTTAAGGAGAAGGGGCATGG + Intergenic
1102957125 12:117066046-117066068 GTGTGTGAAGAGAAGAGGGAGGG - Intronic
1103698806 12:122836723-122836745 CTCTGCAAGGACAAGTGGGACGG - Intronic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1106235017 13:27854049-27854071 CTGTGGAAGGAAAGGAGGGAGGG - Intergenic
1106345229 13:28870493-28870515 CAATGTAAGGAGATGGGGAATGG - Intronic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1107629863 13:42332447-42332469 GTATAGAAGGAGAAGAAGGAGGG + Intergenic
1108773378 13:53733057-53733079 GTATGGAAGGAGAATAGGCAAGG + Intergenic
1109317425 13:60766775-60766797 CCATGGATGAAGAAGAGGGATGG + Intergenic
1109365628 13:61352493-61352515 TTATGTAAGAAAAAGAAGGAAGG - Intergenic
1109568134 13:64146491-64146513 CTAGGTAATGAAAACAGGGAGGG - Intergenic
1111092885 13:83470477-83470499 CTATGTAATTAGAAGAGAAAGGG - Intergenic
1111954223 13:94739581-94739603 ATAAGTAAGAAGAAGAGTGATGG + Intergenic
1112139419 13:96621757-96621779 CTATGACAGGAGATGAGGTAAGG - Intronic
1112194397 13:97210952-97210974 TTGTGTATGGAGAAGAGGGGTGG + Intergenic
1113405247 13:110032896-110032918 CTCTTTAAGGAGAAGCGGGTGGG - Intergenic
1114482683 14:23045361-23045383 CTATGGAAGGAAAAGAGAGGAGG - Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1116402217 14:44521733-44521755 TTCTGTATGGAGGAGAGGGAGGG + Intergenic
1116508482 14:45714790-45714812 CTATGTAAGAAGAAGCGAGGAGG - Intergenic
1116832289 14:49733006-49733028 CTAGGGAAAGAGAAGAGGAAGGG + Intronic
1117771968 14:59142648-59142670 CTATGGAAAGAAAAGAGAGAAGG + Intergenic
1117938488 14:60935288-60935310 CTAGGTAGGTAGATGAGGGAGGG - Intronic
1117959852 14:61152062-61152084 CTGTGAAAGGACAGGAGGGAAGG + Intergenic
1118609017 14:67525511-67525533 TTATGTTAGGAGAAGAATGAGGG - Intronic
1119061100 14:71475533-71475555 TTATGTCAGGAGTAGAGGAAAGG + Intronic
1120444846 14:84581711-84581733 CTACCTAAGGAGAACAGGAAAGG - Intergenic
1120757914 14:88261454-88261476 CCATGAAAGAAGAAAAGGGATGG + Intronic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1121903062 14:97712063-97712085 TTATATAAGGAGCAGAGTGATGG + Intergenic
1121970081 14:98347929-98347951 GTCTGTGAGGAGCAGAGGGAAGG - Intergenic
1126160191 15:45604805-45604827 TTATGTCAGGAGAAGATGGGAGG - Intronic
1126378021 15:48015868-48015890 CTAAGGAAGAAGCAGAGGGAGGG + Intergenic
1127200714 15:56646791-56646813 CTATGAAAGGGAAAGAGGCAAGG + Intronic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127563050 15:60159534-60159556 CTATGGAAGGCAAAAAGGGAAGG + Intergenic
1128194259 15:65736711-65736733 ATATGTAGGTAGAAAAGGGAGGG - Intronic
1128379880 15:67104758-67104780 CTCTGTCAAGAGAAGAGGGTGGG - Intronic
1128659185 15:69485266-69485288 GGATGTATGGAGAAGAGGGAAGG + Intergenic
1128789286 15:70421075-70421097 CTATTTAAGGAGATGAAAGAAGG - Intergenic
1128985447 15:72217234-72217256 CTTTGTCAGGACAAGAGGGAAGG + Intronic
1129139488 15:73584412-73584434 GGAAGGAAGGAGAAGAGGGAAGG + Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1129360070 15:75019075-75019097 GTAGGGAAGGAGAAAAGGGAAGG - Exonic
1132794071 16:1710002-1710024 CTATGTAAGGAAAGGATGCAAGG + Intronic
1133572364 16:7054123-7054145 GTGTGAAAGGAAAAGAGGGAGGG - Intronic
1134407640 16:13975910-13975932 CTATGAAAGTAGACGTGGGAAGG + Intergenic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1138202543 16:55100921-55100943 CTGTGGAAGGAAGAGAGGGAGGG + Intergenic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1138790376 16:59896689-59896711 CTATGCAAGGAGAAAAAGGGAGG + Intergenic
1140185141 16:72762943-72762965 CCATGTAGGGAGAAAAGTGAGGG - Intergenic
1140239988 16:73191900-73191922 ATATGTTGGGAGCAGAGGGAAGG + Intergenic
1141402798 16:83765119-83765141 ATATGTAAGCAGATGTGGGATGG - Intronic
1141552813 16:84817497-84817519 ATCTGTAAGGAGATGAGGGTTGG + Intergenic
1141882408 16:86868684-86868706 CTAGGTATTGAGAAGAGAGATGG + Intergenic
1142214177 16:88822709-88822731 CCCTGCAATGAGAAGAGGGAAGG + Exonic
1142685251 17:1574012-1574034 GGATGAAAGGAGAAGAGGAAAGG - Intronic
1143101962 17:4509463-4509485 CTGTGAAAGGAGGAGAGGAAAGG + Intronic
1144789644 17:17850243-17850265 CTTTGTAAAGAACAGAGGGAGGG + Intronic
1144796288 17:17893412-17893434 CTTTGTGAGCAGCAGAGGGATGG + Intronic
1146573987 17:33976100-33976122 ATATATAAGGAGACCAGGGAAGG - Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1149254856 17:54814429-54814451 ATATCTAAGGAGCAGAGTGAGGG + Intergenic
1149682478 17:58515775-58515797 CTATGGAAGGAAGGGAGGGAAGG + Intronic
1149688302 17:58551848-58551870 TTATGTAAGGAGTAAAGGAATGG + Intergenic
1150410642 17:64938158-64938180 CTAGGTAAGGTGAAAAGAGAGGG + Intergenic
1151138415 17:71969537-71969559 GTATTTTAGGAGAAGAGTGAAGG + Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151859056 17:76745695-76745717 GTGTCTCAGGAGAAGAGGGAGGG - Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152201836 17:78951963-78951985 CTAGGAAGGGAGGAGAGGGAGGG - Intergenic
1152243016 17:79170033-79170055 AGAAGGAAGGAGAAGAGGGAAGG + Intronic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1152561860 17:81082648-81082670 CTGTGGAGGGAGAAGAGGAAAGG - Intronic
1152732415 17:81978758-81978780 CTTTTTATGGAGAAGAGGGGCGG + Intronic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1153776706 18:8460829-8460851 GTGTGTAAGGAGAAGAGAGGAGG + Intergenic
1153803171 18:8689379-8689401 CCAAGCAGGGAGAAGAGGGAAGG - Intergenic
1154960500 18:21303653-21303675 CTTTGTAAGGACAATAGGGCCGG - Intronic
1155218172 18:23661818-23661840 CTAGGTTTGGAGAAGAGGGTTGG - Intronic
1155656137 18:28195188-28195210 CTATTTAAGGAAAAGTGGGAAGG - Intergenic
1155678493 18:28459593-28459615 CCCTGTCAGTAGAAGAGGGATGG + Intergenic
1155739668 18:29272527-29272549 CTATAGAGGAAGAAGAGGGAAGG - Intergenic
1156442775 18:37208183-37208205 CAATGTAGGGGGAGGAGGGAAGG - Intronic
1156515984 18:37680915-37680937 ATCTGTAAGGAAAAAAGGGAGGG + Intergenic
1156764292 18:40632618-40632640 GAAGGGAAGGAGAAGAGGGAAGG + Intergenic
1157119404 18:44895141-44895163 GAAAGAAAGGAGAAGAGGGAAGG + Intronic
1157171889 18:45414865-45414887 CTCTGAAAGGAGAGAAGGGAAGG - Intronic
1157196482 18:45624120-45624142 CTAGGGAAGGGAAAGAGGGAAGG + Intronic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157530689 18:48418212-48418234 CTGAGTATGGAGAGGAGGGAAGG + Intergenic
1157592687 18:48845074-48845096 CTATGGAAGAAGAAAAGGGGAGG - Intronic
1158591428 18:58782131-58782153 CTAGAAATGGAGAAGAGGGATGG - Intergenic
1158613628 18:58966130-58966152 CTACTCAAGGAGAAGAGAGAGGG - Intronic
1158912077 18:62074406-62074428 AAATGAAAGGAAAAGAGGGAGGG - Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162194500 19:8973904-8973926 CTATCTGAAGAGAAGAGAGATGG + Exonic
1163543561 19:17926873-17926895 CCAAGTGAGGAGAAAAGGGATGG + Intergenic
1163627992 19:18401919-18401941 TTTTATAAGGAGCAGAGGGATGG + Intergenic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1165007716 19:32820073-32820095 CTATCGAAGGAGAAGAGGGTGGG + Intronic
1165328699 19:35128919-35128941 CTAAGTGAGGAACAGAGGGAAGG - Intronic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
1167651130 19:50729647-50729669 CTATGGAAGGAAGGGAGGGAGGG + Intergenic
1167721459 19:51182906-51182928 GGATGGAAGGAGAAAAGGGAAGG - Intergenic
1167763517 19:51463864-51463886 GGATGGAAGGAGAAAAGGGAAGG + Intergenic
925228266 2:2205785-2205807 ATATGTGAAGAGAAGGGGGATGG - Intronic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
928014943 2:27647347-27647369 TTATTTAAGAAGAGGAGGGAGGG - Intronic
928206604 2:29289172-29289194 CGAGGACAGGAGAAGAGGGATGG - Intronic
929456592 2:42070601-42070623 GTCTTTAAGGAAAAGAGGGAGGG - Intergenic
929930661 2:46253256-46253278 CTATGCCTGGAGAAGAGAGAGGG + Intergenic
930088773 2:47516968-47516990 CTTTGTAGGGTGGAGAGGGAGGG - Exonic
930790017 2:55315301-55315323 CCAGGGAAGGAGAAGAGGAATGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931086161 2:58832825-58832847 CTATGCAATAAGAAGAGGGAAGG + Intergenic
931381575 2:61758316-61758338 CCATGTATTGAGATGAGGGAAGG - Intergenic
931589950 2:63871825-63871847 CTATTTTAGGAGAAGAAGCATGG + Intronic
931709645 2:64977292-64977314 CCATGTCAGAAGGAGAGGGAAGG - Intergenic
932716088 2:74101464-74101486 CCATGAAAGGAGAGGAGGGCAGG + Exonic
932901567 2:75706885-75706907 GTATGCAATGAGAAAAGGGAAGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935600540 2:104917629-104917651 CTTTGTAAGGAAGTGAGGGAAGG + Intergenic
936584763 2:113746641-113746663 ATAAGTAGGGAAAAGAGGGATGG + Intronic
937246346 2:120496569-120496591 CTACCTAAGGATAAGAGGGAAGG + Intergenic
937681497 2:124649410-124649432 CAACGCAATGAGAAGAGGGAAGG - Intronic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
940982863 2:160023107-160023129 AGAAGTAAGGAGAGGAGGGATGG + Intronic
942085287 2:172437826-172437848 CCATGGCAGGAGGAGAGGGAGGG + Intronic
942379271 2:175371389-175371411 TTAGATAAGGAGATGAGGGAGGG - Intergenic
943415282 2:187593809-187593831 CTATGCAAGGAGAAAAAGTAGGG + Intergenic
943839060 2:192554200-192554222 GAATGGAAGGAGAAGAGGGAGGG + Intergenic
945554236 2:211259486-211259508 TTATGTAAGGAAAAAATGGAGGG + Intergenic
945782098 2:214187898-214187920 ATATTAAAGGAGAAGAGGTATGG - Intronic
947486017 2:230549735-230549757 ACATGTAAGGACAAGTGGGAAGG - Intergenic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948039228 2:234886248-234886270 CTATTTAATGAAAAGAGGGCTGG - Intergenic
948042579 2:234914988-234915010 GAATGTAAGGAGGAGAGGCATGG + Intergenic
1169547868 20:6669330-6669352 CTATGCAGAGAGAAGAGGGTAGG - Intergenic
1170152684 20:13241906-13241928 ATATATAAGGAGAAGAGAAAGGG + Intronic
1170401950 20:15996012-15996034 ATATGTAACCAGAAGTGGGATGG + Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170822769 20:19768187-19768209 CTATAACAGGAGATGAGGGAAGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171779957 20:29409709-29409731 CTCTGGAAGGGAAAGAGGGAGGG - Intergenic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1174072722 20:47910001-47910023 AGATGTAAGGAGTAGGGGGAGGG - Intergenic
1175578829 20:60082959-60082981 ATATGTAAGGAGATTATGGAAGG + Intergenic
1177390589 21:20464866-20464888 CTACATAATGAAAAGAGGGATGG + Intergenic
1177580238 21:23012878-23012900 CTATGTAATGAGTAGAAGGTGGG + Intergenic
1178247097 21:30963819-30963841 CTATGTAAGCAGCAAAGTGAAGG + Intergenic
1179014224 21:37581482-37581504 CTTTGTAAGGAGAGGAGGTTAGG + Intergenic
1179225322 21:39447759-39447781 CAATGGAAGGAGAAGAGCCATGG + Intronic
1180677617 22:17598614-17598636 GTAGGTAAGGAGAGAAGGGAGGG + Intronic
1181341381 22:22182522-22182544 TGAAGTAAGGATAAGAGGGAAGG - Intergenic
1181474733 22:23161201-23161223 ATGTGTCAGGAGAACAGGGAGGG - Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182063998 22:27417540-27417562 CTAGGTAATGACAGGAGGGAAGG - Intergenic
1182148404 22:28011742-28011764 GAAGGTAAGGAGAAGAGGCAAGG + Intronic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1182725308 22:32440708-32440730 GTAGGTCAGGAGAAGAGTGAAGG - Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
1184133730 22:42533707-42533729 CCATGTGAGGAGACGAGAGATGG - Intergenic
949590889 3:5492972-5492994 CTAGGAAGGGAGAGGAGGGAAGG - Intergenic
951715525 3:25640557-25640579 TTGTGTAGGCAGAAGAGGGAGGG - Intronic
952608978 3:35183903-35183925 ATATGTAAGGAGCAGATGCAGGG - Intergenic
953397233 3:42582610-42582632 CTATGTTAAGAGAGGAGGCAGGG + Intronic
956109732 3:65858628-65858650 CTATCTTTGGAGAAGAGGAAAGG + Intronic
956536183 3:70279758-70279780 CCATGGAAGGAAAAGAGGGATGG - Intergenic
958009738 3:87861732-87861754 TTATGTAAGTAGAAGAGCTATGG - Intergenic
960082411 3:113555140-113555162 ATAAGGAAGGAGAAGAGAGACGG - Intronic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962892436 3:139684117-139684139 CTTTGTAAGCAGAACAGGAATGG - Intergenic
962908399 3:139825758-139825780 CTATGGAGGGTGAAGAGAGAGGG + Intergenic
963461598 3:145620909-145620931 CTAGGGATGGAGAGGAGGGAGGG + Intergenic
963677419 3:148330000-148330022 CTAGGCCAGGAGGAGAGGGAGGG - Intergenic
963982328 3:151552492-151552514 TTATGTTAGGGGAAGAGGGAGGG + Intergenic
964649801 3:158997752-158997774 ATACGAAAAGAGAAGAGGGAAGG + Intronic
965311680 3:167135923-167135945 TTGTTTAAGGAGGAGAGGGAAGG + Intergenic
965634669 3:170769147-170769169 CTACCTAAGGAGAAGAGTAAGGG - Intronic
966113365 3:176431046-176431068 AGATGTGAGGAGGAGAGGGAAGG - Intergenic
966451899 3:180072928-180072950 CTGTATTTGGAGAAGAGGGAGGG + Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967373313 3:188772912-188772934 CTATGTATGTATAAGAAGGAAGG + Intronic
967850144 3:194076207-194076229 GTATTTAGGTAGAAGAGGGATGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968309111 3:197668084-197668106 CTATCTAAGGAGTAAAGAGAGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968729854 4:2264575-2264597 CAATGGCAGGAGGAGAGGGAAGG + Intergenic
969101387 4:4771409-4771431 CTTTGAAAGGAGAAGAGTGTGGG + Intergenic
969666819 4:8562603-8562625 CTAAATCAGGAGAAGATGGAAGG + Intronic
970386485 4:15562024-15562046 CTATGTATTGAGAAGAGTGCTGG - Intronic
970423288 4:15924587-15924609 CCATGTAAGGAGGAATGGGAAGG - Intergenic
973726859 4:53785742-53785764 CTCTGTCAGGAGAGGAGAGATGG - Intronic
974217230 4:58865555-58865577 CAATGTCAGGTGAAGATGGAAGG - Intergenic
974431104 4:61797099-61797121 CCATGTAAGGATAAAAGGCAAGG - Intronic
975808200 4:78135512-78135534 TTATGTAAGCATAAGAGGGATGG + Intronic
977475387 4:97500818-97500840 CTATGTAACGTAAAGAGTGAAGG + Intronic
978715777 4:111840803-111840825 CTATATAAGGAGAAGACTGGAGG + Intergenic
979999246 4:127469446-127469468 CTTGGTAAAAAGAAGAGGGAGGG - Intergenic
980729485 4:136808784-136808806 CAATGTAAGGAGAATAGAGGAGG + Intergenic
982802088 4:159718192-159718214 CCATGGAAGTAGAAGAGGCAGGG + Intergenic
983197338 4:164822096-164822118 CATTGTAATGAGAATAGGGATGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
986213630 5:5697981-5698003 CTCAGAAAGGAAAAGAGGGATGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988321146 5:29698309-29698331 GGTTGTAAGGAGAAAAGGGAGGG - Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
988921244 5:35944947-35944969 CCATGTAAGAAGCAGAGAGAAGG + Intergenic
989161884 5:38399180-38399202 CTATGCTAGGTGGAGAGGGAAGG + Intronic
989543422 5:42644447-42644469 TTATGTAATAAGAAGAGAGAGGG + Intronic
990373516 5:55145682-55145704 GTAGGGAAGAAGAAGAGGGAAGG - Intronic
990486268 5:56261831-56261853 CTATGGGAAGAGAGGAGGGATGG + Intergenic
990815062 5:59775066-59775088 CTATATTAGGAGGAAAGGGAAGG - Intronic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
990884882 5:60580033-60580055 CTTTGGGAGGAGAAGAGGGTAGG - Intergenic
990967068 5:61460480-61460502 GTATGTTAACAGAAGAGGGAAGG - Intronic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
991989196 5:72320527-72320549 CTAGGGAAGGAGGGGAGGGATGG + Intronic
992162105 5:74013830-74013852 CTATCTAAGCAGGAGAGGCATGG + Intergenic
994029550 5:95126105-95126127 CTATGGGGGGAGAAAAGGGAGGG + Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
995222713 5:109668902-109668924 CTATCTAAGGAACAGGGGGAAGG - Intergenic
996460557 5:123736125-123736147 CCAAGTTAGGACAAGAGGGATGG + Intergenic
996982766 5:129519625-129519647 CTATAAAATGAGAATAGGGAGGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997875555 5:137543655-137543677 GTGTGTAAGGAGAGGAGGGTAGG + Intronic
998051767 5:139041852-139041874 GACTGTAAGGAGAAGAGGGAGGG + Intronic
998184414 5:139967675-139967697 CTATGAAAGGAGAACAGGGCCGG + Intronic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
998464468 5:142332328-142332350 GTATGTGAGGAGCAGAAGGAAGG + Intergenic
998855176 5:146387736-146387758 CCATTTGAGGAGAAGAAGGAAGG - Intergenic
998965912 5:147540019-147540041 ATATGTAAGGCTGAGAGGGAGGG - Intergenic
999070474 5:148738675-148738697 CTAGGAAAGGAGGAAAGGGAGGG - Intergenic
999315143 5:150578853-150578875 CCAAGTATGCAGAAGAGGGACGG + Intergenic
999679673 5:154045062-154045084 GTAAGAAAGGACAAGAGGGATGG - Intronic
999828022 5:155292716-155292738 CTATGGAAGGAAGACAGGGAGGG + Intergenic
1000015164 5:157269275-157269297 GTAGGTAGGGAGAAGTGGGAGGG + Intronic
1001279926 5:170379363-170379385 CTATCTAAGGAAACCAGGGAGGG + Intronic
1001664452 5:173421106-173421128 AAATGGAAGGAGAAGCGGGAGGG - Intergenic
1002075774 5:176707653-176707675 CTCCGCAAGGAGGAGAGGGATGG + Intergenic
1002085748 5:176774425-176774447 CTCCGTGAGGAGAAGAGGAAGGG + Intergenic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002344337 5:178537118-178537140 CCATGGAAGGCGTAGAGGGAGGG + Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002586773 5:180253477-180253499 CTATGGAGGCAGAAGAGGCAAGG + Intronic
1003411014 6:5863034-5863056 CTCTGTGAGGAGCAGAGGGCAGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003957625 6:11178886-11178908 CTATGAAAGGATAAAAGGGAGGG - Intergenic
1004789784 6:19012038-19012060 CTCTGAAAGGAGAGGAGGCAAGG + Intergenic
1004977351 6:20983127-20983149 CAATTTAAGTAGAACAGGGATGG + Intronic
1005180018 6:23094261-23094283 CTATATAAGCTGAAGAGTGAGGG + Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006082251 6:31574371-31574393 CTATCTAAGGAATGGAGGGAGGG + Intergenic
1006404485 6:33836513-33836535 CTATGTAAGAAATTGAGGGATGG + Intergenic
1007356647 6:41323662-41323684 CTAAGTTAGGAGAAAAGGCAGGG - Intergenic
1007954387 6:45902895-45902917 CTATGTGAGGAGGCCAGGGATGG + Exonic
1008680124 6:53863248-53863270 CTATGTAAAGGGAGGAGGGCAGG - Intronic
1009643345 6:66365136-66365158 ATATGGAAAGAGAAAAGGGAAGG + Intergenic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011552040 6:88538825-88538847 ATCTGTAAGGAGAGGTGGGATGG - Intergenic
1012260859 6:97085876-97085898 CTATGTCAGGCGAAAAGGCAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013330597 6:109095798-109095820 CTAAGTAAGGCCAAGAAGGAAGG + Intronic
1015381231 6:132571693-132571715 CTTTGTAAAGAAAAGAGGAAAGG - Intergenic
1016772405 6:147866428-147866450 CAATGTAATGAAAAGTGGGACGG + Intergenic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017857064 6:158359149-158359171 CTAGGTAAGAGGAAGAGGGGAGG - Intronic
1018529694 6:164749745-164749767 CCATGTAAGGAGCAAAGTGATGG + Intergenic
1019840779 7:3441051-3441073 CTATGTAATGAGATGAAGTAGGG - Intronic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1019956386 7:4418119-4418141 CGCTTTCAGGAGAAGAGGGAGGG - Intergenic
1021254604 7:18375550-18375572 CTAGCTAAGGAGAAAAGGAAAGG - Intronic
1021565709 7:22014460-22014482 CTATGTGATGAGCAGTGGGAGGG + Intergenic
1021586303 7:22212304-22212326 CTATGAAAAGTGAGGAGGGATGG - Intronic
1021593995 7:22295145-22295167 CTATGAAAAAAGAAGTGGGATGG + Intronic
1021638890 7:22719043-22719065 CTAGCTAAGGAACAGAGGGAAGG + Intergenic
1022894432 7:34735279-34735301 CTATGAATGGAGACCAGGGAGGG - Intronic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1024551530 7:50566400-50566422 CTTGGTAAGGGGAAGAGTGAGGG + Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1025914553 7:65855179-65855201 CTATGTATGAGGAAGCGGGAGGG + Intergenic
1026095685 7:67344727-67344749 CTATGGAAGGAAGAGAGGAATGG + Intergenic
1028883842 7:95910040-95910062 CAATGCAAGGAAAAGAGGCAAGG - Intronic
1030004387 7:105102029-105102051 CTATATCAGGAGAAGATGGCTGG - Exonic
1030334699 7:108312435-108312457 CTATGAAAGGACATGAGGGCTGG + Intronic
1031922853 7:127614170-127614192 CTATGCATGGGGCAGAGGGAGGG + Intronic
1032115931 7:129117051-129117073 CTCTGTAAGGGGAATAGGAATGG + Intergenic
1034076754 7:148239398-148239420 CTATGGGAAGAGAAGAGAGAGGG + Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1039483138 8:37890388-37890410 CTTTGAATGGAGTAGAGGGAAGG - Intronic
1039776000 8:40737329-40737351 CGATTTAAGGAGAAGAGGGATGG + Intronic
1041243864 8:55872664-55872686 CAATCTAAGGAGAAAAGTGATGG - Intergenic
1041285358 8:56255498-56255520 CTAGGAATGGGGAAGAGGGATGG + Intergenic
1041529971 8:58854521-58854543 CAATGGAAGGAGAAGAAGGTGGG + Intronic
1041960264 8:63606845-63606867 GCATGTAAGAGGAAGAGGGAGGG + Intergenic
1043096209 8:75977245-75977267 TTGTGTAAGGAGCAGAGGCAGGG + Intergenic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043438690 8:80258154-80258176 CTATGTATGGAGGTGGGGGAAGG - Intergenic
1044043123 8:87395357-87395379 CAAGTTATGGAGAAGAGGGAAGG + Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1047028965 8:120855121-120855143 GGAAGTAAGGAGAAGAGGAAAGG - Intergenic
1048007848 8:130433351-130433373 CTAAGTGAGGAGAGAAGGGAAGG - Intronic
1048144727 8:131830128-131830150 GTAGGAAGGGAGAAGAGGGAGGG + Intergenic
1048976555 8:139676251-139676273 CATTGTTGGGAGAAGAGGGAAGG - Intronic
1049324234 8:142013722-142013744 CTCTGGAGGCAGAAGAGGGAAGG - Intergenic
1050060122 9:1699692-1699714 CAATGTAAAGAGAAGAAGAAAGG - Intergenic
1050293957 9:4185786-4185808 AAATGAAAGGAGAAGAGTGAGGG - Intronic
1050459314 9:5863626-5863648 CTATGTAAGGATCAGAGGGAAGG + Intergenic
1053602979 9:39629727-39629749 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1053860628 9:42383475-42383497 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1054250559 9:62712709-62712731 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1054564667 9:66747221-66747243 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1055576586 9:77666031-77666053 CTATGTACCAAGAAGAAGGAAGG - Intergenic
1057077605 9:92146967-92146989 CTCTGTAAAGAGAAATGGGAGGG - Intergenic
1057602971 9:96474976-96474998 TAATGAAAGGAGAAGATGGAAGG - Intronic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1058765958 9:108182968-108182990 CCATGTAAGGTGTGGAGGGAAGG + Intergenic
1060667017 9:125437988-125438010 CGCTGTAAGGAGAAGAGGAATGG + Exonic
1062479018 9:136742963-136742985 CTGTGTCGGGAGAGGAGGGAGGG + Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187080404 X:15980335-15980357 CCAGGCAAGGAAAAGAGGGAAGG + Intergenic
1187226837 X:17381020-17381042 CAATGTGAGGAGAGAAGGGAGGG + Intronic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1187550358 X:20296779-20296801 TTAAGAAAGCAGAAGAGGGAGGG + Intergenic
1187764295 X:22622659-22622681 CTATGTAAGTTGTAGAGGGCTGG + Intergenic
1188168859 X:26895928-26895950 CTAAGCAAGGAAAAGAGAGAGGG + Intergenic
1189664861 X:43343333-43343355 CTATACCAGGAGGAGAGGGAAGG + Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1194212868 X:91089946-91089968 CTAATTAAGAAGAAGAGAGAGGG - Intergenic
1197012701 X:121586607-121586629 ATATGTAAGGAATAGAGGGCAGG + Intergenic
1197411116 X:126117585-126117607 GTATGTACTCAGAAGAGGGATGG + Intergenic
1197686665 X:129446281-129446303 CTATGTATGCAGAAGAAGGGGGG - Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199583740 X:149389059-149389081 CTAGGTATGGGGAATAGGGACGG + Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200135784 X:153873925-153873947 CGAGGAAGGGAGAAGAGGGAGGG + Intronic