ID: 997303840

View in Genome Browser
Species Human (GRCh38)
Location 5:132824667-132824689
Sequence GTTCCTAGAAGAGGCCCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997303840_997303843 -8 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303843 5:132824682-132824704 CTAGGAACACTTCATCAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 136
997303840_997303844 -7 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303844 5:132824683-132824705 TAGGAACACTTCATCAGGAAGGG 0: 1
1: 0
2: 2
3: 13
4: 160
997303840_997303845 -4 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303845 5:132824686-132824708 GAACACTTCATCAGGAAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 139
997303840_997303848 5 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303848 5:132824695-132824717 ATCAGGAAGGGAGGGGAGCCAGG 0: 1
1: 1
2: 5
3: 80
4: 588
997303840_997303847 -2 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303847 5:132824688-132824710 ACACTTCATCAGGAAGGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 209
997303840_997303850 20 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303850 5:132824710-132824732 GAGCCAGGCAGGCACAATGCAGG 0: 1
1: 1
2: 6
3: 29
4: 278
997303840_997303846 -3 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303846 5:132824687-132824709 AACACTTCATCAGGAAGGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 204
997303840_997303849 9 Left 997303840 5:132824667-132824689 CCAGTGGGGCCTCTTCTAGGAAC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 997303849 5:132824699-132824721 GGAAGGGAGGGGAGCCAGGCAGG 0: 1
1: 1
2: 24
3: 265
4: 1993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997303840 Original CRISPR GTTCCTAGAAGAGGCCCCAC TGG (reversed) Exonic
902334913 1:15749246-15749268 TTTCCTAGCGGAAGCCCCACGGG + Intergenic
903575199 1:24335429-24335451 CTTCCCAGCAGAGGCCCTACAGG - Intronic
905184757 1:36188262-36188284 GTTCCTTTGAGAGGGCCCACGGG - Intergenic
907495702 1:54842901-54842923 GTTTCTAGAAGTGGTCCTACGGG - Intergenic
910392116 1:86756258-86756280 GTTCCTGGAATAGCACCCACTGG - Intergenic
912422040 1:109548979-109549001 GTTCCTAGCTGAGGCCCCAGAGG + Intronic
914845698 1:151282506-151282528 CTTCCTAGAAGCCGCCCCAGGGG - Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
918538830 1:185605146-185605168 GCTACTAGAAAAGGCCCCAAAGG + Intergenic
920355996 1:205373146-205373168 GTACCTAGAATAGCCCCCTCTGG + Intergenic
924387789 1:243515570-243515592 ATTCCTAGAACAGACCACACTGG + Intronic
1063299176 10:4836391-4836413 GTTCCTGGAAGTTGACCCACAGG + Intronic
1063300856 10:4847738-4847760 GTTCAGAGTAGAGGCCACACAGG - Exonic
1063454599 10:6174341-6174363 GTTCTTAGAAGAGTCCTCTCTGG + Intronic
1064254585 10:13732931-13732953 GAGCCCAGAAGAAGCCCCACAGG - Intronic
1065361231 10:24890882-24890904 GATCCTAGAAGAGGCTTCTCAGG + Intronic
1069698514 10:70405095-70405117 TTTGCTGGACGAGGCCCCACGGG + Intronic
1071976207 10:90957866-90957888 GGTGCTGGAAGAGGCACCACAGG + Intergenic
1072282151 10:93876181-93876203 GTGACTAGTAGTGGCCCCACTGG + Intergenic
1073002544 10:100296347-100296369 GTTCCAAGATGAGGCCCCAAGGG + Intronic
1074227891 10:111505455-111505477 GTGCCTGGAAGAGTCCCAACTGG + Intergenic
1075446153 10:122514698-122514720 GTAGATAGAAGAAGCCCCACGGG + Exonic
1077075215 11:697809-697831 GCTCCTGGAAGAGGCACCACAGG - Intronic
1080228613 11:29989744-29989766 GTTCCTAGAACTGGTCCCAGTGG - Intergenic
1085641678 11:78196806-78196828 GTTCCTAGAGCAGGCCCAGCAGG + Exonic
1097066843 12:56326875-56326897 GTCATTAGCAGAGGCCCCACAGG + Exonic
1104001763 12:124864424-124864446 GTCCCTGGAAGAAGCCCCGCAGG + Intronic
1113422117 13:110178967-110178989 GTTCCAGGAATAGGCCCCCCTGG - Exonic
1114678163 14:24459475-24459497 GCTCCTACAAAAGGTCCCACTGG - Intergenic
1119758396 14:77134616-77134638 CTTGCTAGAAGAGGCCCCCAAGG + Intronic
1122408446 14:101513990-101514012 GTTCCTACAACAGAACCCACAGG + Intergenic
1122773202 14:104106255-104106277 GGTCCTGGCAGAGGCCCCACAGG - Intronic
1122773216 14:104106294-104106316 GGTCCTGGCAGAGGCCCCACAGG - Intronic
1122777602 14:104128481-104128503 ATTCCTAGAAGAGGTCTCAATGG - Intergenic
1122817080 14:104319172-104319194 GGTACTGGGAGAGGCCCCACGGG - Intergenic
1124612457 15:31217432-31217454 ATTCCTAGAAGAGGAACTACTGG + Intergenic
1125448386 15:39782631-39782653 GTTCCTCGAGGAGGCCCGGCGGG - Exonic
1125754560 15:42054167-42054189 ACTCCTAGAATAGGCTCCACAGG + Intergenic
1130370498 15:83282910-83282932 GGGCCTAAAAGAGGCCCCACCGG - Intronic
1130904773 15:88232727-88232749 GTACCAAGAAAAGGCCCCAGAGG + Intronic
1137421964 16:48342526-48342548 GTGCCAAGAAAAGGCCCTACTGG + Intronic
1142868527 17:2805996-2806018 GTCCCTAGAAGTGGCACCTCTGG + Intronic
1146013369 17:29213384-29213406 GCTCCTAGAAGAGGGGCCAGTGG + Intergenic
1149993973 17:61397334-61397356 GTTCCTTTAAGAGGCCCCGGGGG - Intergenic
1151164416 17:72191740-72191762 GTTTCTAGAAGAGTCCCAAAGGG - Intergenic
1151752015 17:76044641-76044663 GTTCCTTGAACTGGCCACACTGG + Intronic
1151972768 17:77467401-77467423 GTTCCTGGGAGAGACCCCAGGGG + Intronic
1155280984 18:24239559-24239581 GTTGCCAGAAAAGGCCCCATGGG - Intronic
1156607912 18:38690247-38690269 ATTCATAAAAGAGCCCCCACTGG - Intergenic
1159202193 18:65201878-65201900 TTTCCTAGAAGATGCCCTAAGGG + Intergenic
1160373723 18:78395327-78395349 GCTCCTAGAAGATGTCCAACTGG + Intergenic
1161121340 19:2528577-2528599 GTGACTAGGAGAGGCCCCACAGG + Intronic
1163847111 19:19643909-19643931 GCTCCTGGGAGAGGCCCCCCGGG - Intergenic
1166300988 19:41912218-41912240 GTTTCTAGAAGGGGTCACACTGG - Intronic
1167006356 19:46778671-46778693 GTACCTGGAAGAGGTCCCAAAGG + Exonic
925801899 2:7609777-7609799 GTTCAGAGAAGATGCCCCAGGGG - Intergenic
928319739 2:30273575-30273597 GCTCCTAGAAGAGACCCTCCAGG - Intronic
928573078 2:32627930-32627952 GTTCTTGGAAGCGGTCCCACTGG + Intergenic
928702424 2:33912476-33912498 GGCCCTAGAAGAGGCCCCTATGG + Intergenic
932470621 2:71952846-71952868 ATTGCTGGAAGAGGCCCCAGTGG - Intergenic
943211013 2:184965976-184965998 ATTCTTAGAAGAAGCCCCATTGG - Intergenic
946407829 2:219501538-219501560 GTTCCTAGAAGCCGCCCAGCAGG + Exonic
1169688550 20:8304574-8304596 GTCCACAGAAGAGGCCCCTCAGG - Intronic
1172588624 20:36102287-36102309 GTCCCTAGGAGAGGATCCACAGG + Intronic
1182294192 22:29303554-29303576 TTTCCCAGAGGTGGCCCCACAGG + Intergenic
1183180243 22:36255085-36255107 GTTCCTAGAAGAAGCCCAGATGG - Intronic
1184163772 22:42715396-42715418 GTTCCTAGAAGTGAGCCCTCTGG + Intronic
953413375 3:42702347-42702369 GCTCCTTGCAGAGGCCTCACTGG - Intronic
954324537 3:49856219-49856241 CCTCCTAGACGAGGCCCCACGGG - Intronic
955091306 3:55753404-55753426 GTTCACAGAAGATCCCCCACAGG + Intronic
958178044 3:90022045-90022067 GCTGATAGAAGGGGCCCCACTGG + Intergenic
962866294 3:139450461-139450483 CTTTCAAGAACAGGCCCCACTGG + Intergenic
967287478 3:187887500-187887522 GTCCCTAGAACTGGCCCCACAGG + Intergenic
968229375 3:196996295-196996317 GTCCCTGGAAGAAGCCCCAGGGG - Intronic
969619240 4:8270592-8270614 AGTCCTAGATGAGGCCCCTCGGG - Intronic
971294617 4:25377326-25377348 GTACCTGCAAGAGTCCCCACCGG - Exonic
976611792 4:87038065-87038087 TTTCCTGGAAGAGCCCCCAGGGG - Intronic
979824947 4:125221196-125221218 GCCCCTATAAGAGTCCCCACTGG + Intergenic
980483285 4:133418581-133418603 GTTTCAAGAAGAGGTCCCAGAGG + Intergenic
985834843 5:2262752-2262774 GGTCCTGGGAGTGGCCCCACTGG - Intergenic
992169289 5:74086200-74086222 GCTCCTAGTGGAGGCCCTACTGG - Intergenic
997303840 5:132824667-132824689 GTTCCTAGAAGAGGCCCCACTGG - Exonic
999342375 5:150783241-150783263 GTTCCTAGATGGGGCCACACTGG - Intronic
999723617 5:154417172-154417194 TATCCCACAAGAGGCCCCACAGG + Exonic
1001313717 5:170628537-170628559 GTTCCTAGCAGATTCCTCACTGG - Intronic
1001797157 5:174511945-174511967 ATTCCTAGAAGTGGCCTGACTGG - Intergenic
1006210295 6:32387675-32387697 GTACCTAGAAGATGCTCCAGTGG - Intergenic
1006408151 6:33856968-33856990 GGTCCTGGTAGATGCCCCACAGG + Intergenic
1009221716 6:60991749-60991771 GTACCTAGAAGAGGGTCCAGAGG - Intergenic
1011784679 6:90830578-90830600 ATTTCTCCAAGAGGCCCCACGGG - Intergenic
1011961652 6:93098387-93098409 CTTCCTAGCAGAGGCCACAGGGG - Intergenic
1011981493 6:93384626-93384648 GTGCCTAGAAGTGCCCTCACAGG + Intronic
1013810263 6:114037013-114037035 TTTCCTAGGAGAGGGCCCAAAGG - Intergenic
1017983271 6:159421237-159421259 ATTCCTAGAAGTTGGCCCACAGG - Intergenic
1020230461 7:6314458-6314480 GTTCCTAGAAGAGACAGCTCCGG - Intergenic
1020279673 7:6643890-6643912 CTTCCTGGTAGAGGCCCCGCTGG - Exonic
1023034638 7:36119762-36119784 GTTCCTAGAAGGGGGCACATGGG + Intergenic
1023584225 7:41712416-41712438 GTTCCTAGAAGTGGAATCACTGG + Intergenic
1024855000 7:53768636-53768658 GTTCCTAGAATATGCCTCAGAGG - Intergenic
1028918212 7:96283098-96283120 ATTCCTAGAAGTGGCACCATTGG - Intronic
1029787962 7:102811833-102811855 GTTCCTAGGAGTGGGCACACAGG - Intergenic
1042292009 8:67178703-67178725 ATTCCAGGAAGAGGCCCCAGTGG + Intronic
1044831834 8:96257876-96257898 ATTCCTAGAATAGGACCCATAGG + Intronic
1045722856 8:105133990-105134012 GAACCCAGAAGAGGCCCTACAGG - Intronic
1047784405 8:128139669-128139691 TCTCCTAGAAGAGTCCACACTGG - Intergenic
1048255581 8:132902768-132902790 GTTCCTGGAGGAGGCCACACCGG - Intronic
1049252209 8:141595388-141595410 CTCCCTAGAAGAGGCCCCTCAGG + Intergenic
1053385869 9:37687496-37687518 GATCCTAGAGGGGGCCCAACTGG + Intronic
1057445212 9:95109397-95109419 ATTCCTAGAAGTGGAACCACAGG + Intronic
1057517685 9:95735942-95735964 GTTCCTAGATCAAGGCCCACAGG + Intergenic
1062324505 9:136005645-136005667 GTTCCCAGAAGAGGGTCCTCTGG - Intergenic
1189787306 X:44570453-44570475 GTTCCCAGAAAATGACCCACAGG - Intergenic
1197893241 X:131286183-131286205 GTTCTTATACGATGCCCCACAGG - Intronic
1199612685 X:149631553-149631575 AGTCCTGGAAGAGGCCCCTCAGG + Exonic