ID: 997303860

View in Genome Browser
Species Human (GRCh38)
Location 5:132824792-132824814
Sequence ATCACCGCAGCCTCTTTCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997303855_997303860 26 Left 997303855 5:132824743-132824765 CCTCTGTTCACTGTCAGCAGGGC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 171
997303853_997303860 27 Left 997303853 5:132824742-132824764 CCCTCTGTTCACTGTCAGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 204
Right 997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997303860 Original CRISPR ATCACCGCAGCCTCTTTCTG AGG Exonic
900222208 1:1515149-1515171 TTCACTGCAGCCTCTGTCTCCGG + Intronic
900396059 1:2453704-2453726 CTCTCTGCTGCCTCTTTCTGGGG + Intronic
901234098 1:7658234-7658256 ATCACGGGAGCCTCTCCCTGTGG - Intronic
903754865 1:25653661-25653683 ACCACAGCAGCCTCGTTCTGGGG - Intronic
904597805 1:31657672-31657694 ATCAACGCAGACTTTTTCTGGGG - Intronic
905782860 1:40728010-40728032 ATCACTGCAGCCTCATGCTTTGG + Intronic
906166718 1:43691861-43691883 ATCATCTGAGCCCCTTTCTGAGG - Intronic
907933326 1:59019875-59019897 ATGAAGGCAGCCTCTTTTTGGGG + Intergenic
908169005 1:61486315-61486337 CTCACAGCAGCCTCTATATGAGG + Intergenic
908732256 1:67238272-67238294 CTCACTGCAGCCTCTATCTCTGG - Intronic
911803589 1:102176344-102176366 ATCCCTGCATTCTCTTTCTGTGG - Intergenic
914799442 1:150949801-150949823 AACACCACAGCCTCTTTCCTTGG + Intronic
915060267 1:153175981-153176003 CTCACTGCAGCCTCTGTCTCCGG - Intergenic
915551280 1:156636213-156636235 CTCACTGCAGCCTCATACTGTGG + Intergenic
916946497 1:169734016-169734038 ATCACTGCTGCCTCTGTCTCAGG + Exonic
918275114 1:182946364-182946386 ATCCACCCAGGCTCTTTCTGTGG + Intronic
920752537 1:208693615-208693637 ATGATCTCAGCCTGTTTCTGTGG - Intergenic
923324040 1:232864575-232864597 ATCACCGGAGGGTCTTTCAGAGG - Intergenic
1064316625 10:14263601-14263623 GTCCCAGCAGCATCTTTCTGGGG - Intronic
1066284213 10:33948820-33948842 CTCACTGCAGCCTCTCTCTTGGG + Intergenic
1068041816 10:51834565-51834587 ATCACTGCAGCCTCAATCTCTGG - Intronic
1068654654 10:59562364-59562386 TTCACTGCAGTCTATTTCTGTGG + Intergenic
1069829248 10:71272435-71272457 ACCACAGCAGCCTCCCTCTGAGG + Intronic
1070797430 10:79224784-79224806 CTCACCGCAGGCTCTGCCTGTGG - Intronic
1071474800 10:86016892-86016914 ATCAGAGCACCCTCATTCTGTGG - Intronic
1071955694 10:90757028-90757050 ATCCCCGCCCCCTTTTTCTGAGG - Intronic
1075435922 10:122441642-122441664 ATGCACGCAGCCTCTTTCAGTGG - Exonic
1075729599 10:124628378-124628400 AATACCGCAGCCTCCTTCGGAGG - Intronic
1076228305 10:128798973-128798995 GTCACCCCAGCCTCTGTCTTTGG + Intergenic
1076348413 10:129796786-129796808 ACCAGCGTAGCGTCTTTCTGTGG - Intergenic
1077495217 11:2884003-2884025 CTCACCGCAGCCTCTTGCGCGGG + Exonic
1078038556 11:7835148-7835170 ATCACTGCTGCCTCTTCCTTTGG + Intergenic
1081743202 11:45455313-45455335 ATCATGGCAGCCTTTTTCTTGGG - Intergenic
1082001093 11:47394153-47394175 ATGACCGCGTCTTCTTTCTGAGG + Intergenic
1082015432 11:47482738-47482760 ATCAGCGCAGCATCTGTGTGGGG - Exonic
1082201619 11:49378068-49378090 ATCTCCGAGGCGTCTTTCTGTGG + Intergenic
1083134021 11:60654738-60654760 AGCACTGTAGCCCCTTTCTGAGG + Intergenic
1083488548 11:62998586-62998608 AGCACCATAGACTCTTTCTGTGG + Intronic
1086654050 11:89328157-89328179 ATCTCCGAGGCGTCTTTCTGTGG - Intronic
1086840758 11:91681525-91681547 ACCACAGAAGCATCTTTCTGAGG + Intergenic
1089129450 11:116200488-116200510 CTCACTGCTGACTCTTTCTGGGG + Intergenic
1089442599 11:118529750-118529772 ATCACCACTGCATCTCTCTGGGG - Intronic
1091301268 11:134509683-134509705 AGCACCGCCACCTCTTTGTGGGG + Intergenic
1096096855 12:48941097-48941119 ATCACAGCAGCTGCTTTCTGGGG + Exonic
1098139122 12:67433528-67433550 ATCACCACAGCCTCTTTGAATGG + Intergenic
1099673807 12:85730860-85730882 TTCACTGCAACCTCTTTCTTGGG - Intergenic
1102352233 12:112202277-112202299 CTCACCGCAACCTCTGTCTCTGG + Intronic
1102454247 12:113061773-113061795 CTCACTGCAGCCTCTTTCCCCGG + Intronic
1102635521 12:114320229-114320251 ATCCCAGCGGCCTCTTTCAGAGG + Intergenic
1106551166 13:30772338-30772360 CTCTCCCCAGCCTTTTTCTGAGG - Intergenic
1108205693 13:48087288-48087310 CTCACCGCAGCCTCTGCCTCCGG - Intronic
1113515156 13:110888911-110888933 GTCACCACAGCCTACTTCTGGGG + Intronic
1114017597 14:18445436-18445458 AACACTGCTGCTTCTTTCTGAGG - Intergenic
1117741124 14:58820252-58820274 CACACCGCAGGCTCTCTCTGGGG - Intergenic
1126161125 15:45614560-45614582 CTCACTGCAACCTCTTTCTCCGG + Intronic
1128557611 15:68642336-68642358 GTCACCGCAGGCTCTCCCTGGGG - Intronic
1129372798 15:75108719-75108741 ACCACAGCTGCCTCTTGCTGGGG - Intronic
1133724088 16:8521381-8521403 ATCAACGTAGCCTCTTTCTTAGG + Intergenic
1135029127 16:19023795-19023817 TTCACTGAAGCTTCTTTCTGTGG - Intronic
1136141299 16:28290559-28290581 CTCACCGCAACCTCTGCCTGCGG - Intergenic
1136364529 16:29803572-29803594 ATCACCACAGCCTTTTTCAGGGG - Exonic
1138292085 16:55856429-55856451 ATCTCAGGAGCCTCCTTCTGTGG + Exonic
1138625033 16:58244770-58244792 ATGCCTCCAGCCTCTTTCTGTGG + Intronic
1139733995 16:68971703-68971725 CTCACTGCAGCCTCTTCCTCTGG + Intronic
1143781800 17:9233090-9233112 ACCACCTCAGCCTCCTTCGGAGG + Intronic
1146838120 17:36128557-36128579 AACAGCCCAGCCTCTGTCTGTGG + Intergenic
1147139348 17:38452654-38452676 ATCACCACAGCCACTTACTGTGG - Intronic
1147474370 17:40696055-40696077 ATCAGCGAAGCCTCTCTCTGTGG - Intergenic
1147594686 17:41709239-41709261 ATCCCTGCTGCCTCTTTCAGTGG + Intergenic
1147675325 17:42201439-42201461 ACCACCACAGCTTCTGTCTGTGG + Exonic
1148738306 17:49877552-49877574 ATCCCCTCACCCTCTTCCTGTGG + Intergenic
1148904134 17:50900789-50900811 AGCACCGCAGTCTCCTTTTGGGG + Intergenic
1153112275 18:1606123-1606145 CTCACCGCAGCCTCTGCCTCTGG + Intergenic
1155035662 18:22022850-22022872 CTCACTGCAGCCTCGATCTGGGG + Intergenic
1156571787 18:38263926-38263948 ATCACTACAGCTTCTTTCAGTGG + Intergenic
1157570963 18:48711934-48711956 ATCACCACTGCCTCTTCCTGGGG + Intronic
1159007715 18:63027307-63027329 ATCACTGCTGCCTCTTTTTTTGG + Intergenic
1159991933 18:74919082-74919104 ATCCCTGCACCCTCTGTCTGGGG + Intronic
1160586742 18:79917421-79917443 ATCACCACAGCCTCGTGGTGAGG - Intronic
1160727585 19:624478-624500 GTCACCCCACCCTCTCTCTGCGG + Intronic
1160880010 19:1315465-1315487 CTCACAGCGGCCTCTGTCTGTGG - Intergenic
1161579485 19:5072965-5072987 ATCACTCCAGCCTCTGTCTCTGG + Intronic
1161625497 19:5324151-5324173 CTCACCACAGCCTCTGTCTCAGG - Intronic
1161664807 19:5568773-5568795 CTCACTGCAACCTCTGTCTGCGG - Intergenic
1162761878 19:12893325-12893347 ATCTCCACAGCCACTTTCAGAGG - Intronic
1164483665 19:28636443-28636465 ATCAGGGCAGGCACTTTCTGTGG - Intergenic
1165334079 19:35156883-35156905 ATCCCAGCAGCCTCCTTCTTGGG - Intronic
1167344370 19:48936058-48936080 ATCACCGCCGCCTTGTGCTGGGG - Exonic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
1168087101 19:54056293-54056315 CTCACCGCAGCCTCTGCCTCTGG + Intronic
925628755 2:5867718-5867740 ATTACCCTAGCCTGTTTCTGTGG - Intergenic
932152318 2:69384618-69384640 CTCACTGCAGCCTCTGTCTCCGG - Intronic
932175425 2:69596578-69596600 ATCAGAGGAGCCTCTATCTGTGG - Intronic
933949294 2:87314269-87314291 ATCTGCGTAGCCTCTTCCTGGGG - Intergenic
934508383 2:94916084-94916106 CTCACTGCAACCTCTGTCTGAGG - Intergenic
934657783 2:96125001-96125023 ACCACTGCAGCCTGTTCCTGGGG + Intronic
936330901 2:111547328-111547350 ATCTGCGTAGCCTCTTCCTGGGG + Intergenic
936433310 2:112482419-112482441 CTCGCCGCAGCCTCTTCCAGTGG - Exonic
937296200 2:120811316-120811338 ATCCCCCCAGCCTCATTCTTTGG + Intronic
941504636 2:166327099-166327121 ATTACAGCTGCCTCCTTCTGTGG - Intronic
944010510 2:194968986-194969008 ATCAGCACAGCTGCTTTCTGAGG - Intergenic
944202256 2:197120326-197120348 ATCACTGAAGCCACTATCTGGGG + Intronic
944569050 2:201024413-201024435 CTCACTGCAGCCTCTATCTCCGG - Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
947569035 2:231216559-231216581 CTCACCCCATCCTCTCTCTGAGG - Intronic
947751534 2:232535249-232535271 ACCACCCCAGCCTTTTCCTGGGG + Exonic
948568180 2:238899517-238899539 AGCCCCGCTGCCTCTCTCTGTGG - Intronic
1169176620 20:3521854-3521876 CTCACTGCAGCCTCTATCTCTGG + Intronic
1170214515 20:13877154-13877176 ATAACAGCAGCCTTTATCTGGGG - Intronic
1172345054 20:34191493-34191515 AGCACTGCAGCCTCCTTTTGTGG - Intergenic
1174058647 20:47817010-47817032 CTCACTGCAGCCTCTGTCTCAGG + Intergenic
1174181916 20:48680302-48680324 ATCACAGCAGCCTCTTTGCTGGG + Intronic
1174413799 20:50353648-50353670 AGCTCCGCAGCCTCTTTCTCTGG - Intergenic
1175502276 20:59459006-59459028 ATAACCACAGCTTCTTTCTCAGG - Intergenic
1179530650 21:42016476-42016498 ATCAGCAAAGCCTCTGTCTGGGG - Intergenic
1180442102 22:15376305-15376327 AACACTGCTGCTTCTTTCTGAGG - Intergenic
1180905318 22:19406567-19406589 ATCTCAGCACACTCTTTCTGTGG - Intronic
1181506674 22:23363156-23363178 ATCTCAGGAGCCTCCTTCTGTGG + Intergenic
1181601034 22:23952036-23952058 ATCCCAGCAGCAGCTTTCTGAGG - Intergenic
1181607475 22:23989290-23989312 ATCCCAGCAGCAGCTTTCTGAGG + Intergenic
1182023171 22:27098111-27098133 TTCACACAAGCCTCTTTCTGTGG - Intergenic
1183124222 22:35759969-35759991 ACCACGGCAGCCGCTTTCAGAGG - Exonic
1185031235 22:48444199-48444221 ATCAACCCAGCCTCTGTCTATGG + Intergenic
954608149 3:51929546-51929568 CTCACCCCCACCTCTTTCTGGGG - Intergenic
954622225 3:52002767-52002789 ATCTCCGTAGCCTCCTTTTGTGG - Intergenic
956172815 3:66446016-66446038 ATCACAGCTGCCTCTCTCTAAGG + Intronic
963105349 3:141642472-141642494 ATAACCACAGCATTTTTCTGAGG - Intergenic
963457746 3:145567019-145567041 ATGACCTCAGACTCCTTCTGTGG + Intergenic
966711110 3:182973731-182973753 CTCACTGCAGCCTCTGTCTCCGG - Intronic
966879068 3:184339532-184339554 CTCACCGCAGCCTCTGCCTCTGG + Intronic
968314389 3:197710524-197710546 CTCACCGCAGCCTCTGACTCTGG - Intronic
968896025 4:3403934-3403956 TTCACCCCAGCCTCATACTGGGG - Intronic
970454120 4:16205085-16205107 AAAACGCCAGCCTCTTTCTGTGG + Intronic
971946545 4:33286526-33286548 ACCACAGCTGCCTCTTTCTCTGG + Intergenic
981573230 4:146175931-146175953 TTCACCGCAGGCCCTTTCCGGGG - Exonic
982049960 4:151490412-151490434 ATCACTGCAGTCTGTTTCTCAGG + Intronic
982627979 4:157792078-157792100 ATCACCGCAGCCTCTTCTTTTGG + Intergenic
985927036 5:3026865-3026887 ATGACCCCACCCTCTTCCTGGGG - Intergenic
986200517 5:5574314-5574336 ATCCCCGCAGCCTCCCTGTGGGG - Intergenic
987057349 5:14206548-14206570 GTCCCAGCAGCCTCTTTCTCAGG + Intronic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
992786123 5:80172245-80172267 CTCACCGCAGCCTCTGCCTCTGG - Intronic
993372307 5:87108111-87108133 ATCACGGCAGCCACTTCCTTTGG - Intergenic
994410250 5:99398791-99398813 ATCAGCTCAATCTCTTTCTGTGG + Intergenic
994483567 5:100366486-100366508 ATCAGCTCAATCTCTTTCTGTGG - Intergenic
995694032 5:114859591-114859613 ATCACAGAAGCATTTTTCTGTGG + Intergenic
997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG + Exonic
998733068 5:145103424-145103446 TTCACCCCAGCCTTTTGCTGGGG + Intergenic
1002480042 5:179494527-179494549 CTCACCGCAGCCTCTGCCTCTGG - Intergenic
1005646598 6:27845291-27845313 AGCACTGCAGACTATTTCTGAGG - Intronic
1006055979 6:31384812-31384834 CTCAGCACAGCCTCTTCCTGGGG - Intergenic
1007458426 6:41998751-41998773 CTCACCGCAACCTCTGTCTCCGG + Intronic
1010310909 6:74384649-74384671 GTCACTACAGTCTCTTTCTGCGG - Intergenic
1010774412 6:79868869-79868891 GTAACGGCAGACTCTTTCTGTGG + Intergenic
1013040036 6:106424429-106424451 CTCACAGTAGCCTCCTTCTGGGG - Intergenic
1014437223 6:121434541-121434563 ATCACTGAAGCCTGTTTATGAGG + Intergenic
1015532435 6:134234327-134234349 CTCACTGCAGCCTCTGTCTCTGG - Intronic
1017497752 6:154995942-154995964 TTCGCCGCAGCGCCTTTCTGAGG - Intronic
1017947116 6:159104676-159104698 ATCACCGCATCCACTTCCTGAGG + Intergenic
1018783415 6:167089823-167089845 ATCACACCAGCCTCTTGGTGTGG + Intergenic
1020141810 7:5615799-5615821 ATCGCCGCAGCATCTTCCTCGGG - Intergenic
1022358114 7:29634974-29634996 TTCATCCCAGCCTCTATCTGGGG - Intergenic
1023002968 7:35830107-35830129 CTCACTGCAACCTCTTTCCGAGG - Intronic
1024773037 7:52747317-52747339 TTCACCAAAGCCTTTTTCTGAGG - Intergenic
1025003749 7:55339632-55339654 GACACAGCAGCCCCTTTCTGAGG + Intergenic
1025064022 7:55837655-55837677 CTCACCGCAACCTCTGCCTGCGG + Intronic
1027251508 7:76401488-76401510 CTCACTGCAGCCTCTTCCTCTGG + Intronic
1029754951 7:102567894-102567916 ATCACCGCCGCCTCTCCCTGAGG + Intronic
1029772901 7:102666974-102666996 ATCACCGCCGCCTCTCCCTGAGG + Intronic
1030892956 7:115023425-115023447 ATCACCACATCCTCTTTTTTGGG - Intergenic
1046416838 8:113927306-113927328 ACCACCACAGCTTCTTTCTCCGG - Intergenic
1047227971 8:122972731-122972753 ATCATCGCAGCAACTTTCTAAGG + Intronic
1047503262 8:125458674-125458696 AACAGTGCAGCCTGTTTCTGAGG - Intergenic
1048140016 8:131785261-131785283 ATCATCACAGCCCCTCTCTGTGG + Intergenic
1049913002 9:287897-287919 GTCACCGCAGCTTGTTCCTGTGG + Intronic
1060906090 9:127306809-127306831 CTCACTGCAACCTGTTTCTGAGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062607514 9:137354816-137354838 CTCACCACGGCCTCCTTCTGGGG + Intronic
1187218255 X:17298163-17298185 CTCACTGCAGCCTCTGCCTGTGG - Intergenic
1187936719 X:24343415-24343437 ATCAGGGCAGCCTCTGTCTGGGG + Intergenic
1187943881 X:24407893-24407915 ATCAGGGCAGCCTCTGTGTGGGG - Intergenic
1188762154 X:34045859-34045881 AAGACGGCAGCCTTTTTCTGGGG + Intergenic
1192180191 X:68911413-68911435 TGCACAGCAGCCTCCTTCTGGGG + Intergenic
1192988597 X:76427590-76427612 ACCACCGCATCCACTTTCTCAGG + Intergenic
1193073678 X:77333036-77333058 AGCAAAGCAGCCTCATTCTGTGG - Intergenic
1194136710 X:90152487-90152509 ATGAACGCAGTCTCTTTCTCCGG - Intergenic
1195054651 X:101132012-101132034 ATCATCTCATCCTTTTTCTGAGG + Intronic