ID: 997304640

View in Genome Browser
Species Human (GRCh38)
Location 5:132828531-132828553
Sequence ACTCTTTCTGAGTCCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 174}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997304633_997304640 14 Left 997304633 5:132828494-132828516 CCACCCGACTGCTCAGACATTAG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304634_997304640 11 Left 997304634 5:132828497-132828519 CCCGACTGCTCAGACATTAGCCC 0: 1
1: 0
2: 0
3: 2
4: 97
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304637_997304640 -10 Left 997304637 5:132828518-132828540 CCTTTCTCTTCCTACTCTTTCTG No data
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304630_997304640 30 Left 997304630 5:132828478-132828500 CCCTCATCTAGGAAGCCCACCCG No data
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304636_997304640 -9 Left 997304636 5:132828517-132828539 CCCTTTCTCTTCCTACTCTTTCT 0: 1
1: 0
2: 40
3: 385
4: 2700
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304631_997304640 29 Left 997304631 5:132828479-132828501 CCTCATCTAGGAAGCCCACCCGA No data
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304635_997304640 10 Left 997304635 5:132828498-132828520 CCGACTGCTCAGACATTAGCCCT 0: 1
1: 0
2: 0
3: 13
4: 143
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174
997304632_997304640 15 Left 997304632 5:132828493-132828515 CCCACCCGACTGCTCAGACATTA No data
Right 997304640 5:132828531-132828553 ACTCTTTCTGAGTCCAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997304640 Original CRISPR ACTCTTTCTGAGTCCAGCTT GGG Intronic