ID: 997305589

View in Genome Browser
Species Human (GRCh38)
Location 5:132833655-132833677
Sequence TCTCCCTTAGTGATGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997305586_997305589 -9 Left 997305586 5:132833641-132833663 CCACAAAGCTGGAGTCTCCCTTA No data
Right 997305589 5:132833655-132833677 TCTCCCTTAGTGATGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997305589 Original CRISPR TCTCCCTTAGTGATGGTGGT TGG Intergenic
No off target data available for this crispr