ID: 997309229

View in Genome Browser
Species Human (GRCh38)
Location 5:132866274-132866296
Sequence CCTGGCCAGCGCTGCCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 1, 2: 6, 3: 53, 4: 877}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997309229 Original CRISPR CCTGGCCAGCGCTGCCCCGG AGG Intronic
900114823 1:1023992-1024014 CCTGGCCAGCCCCACCCCAGGGG - Intronic
900138567 1:1129103-1129125 CCTGGCCAGCACAGCCCTGCAGG - Intergenic
900147668 1:1165512-1165534 CCAGGCCAGCTCTGGCCCTGTGG + Intergenic
900203072 1:1419964-1419986 CCTGGCTCCAGCTGCCCCGGTGG + Intronic
900226126 1:1534403-1534425 CCTGGCTCCTGCTGCCCCGGGGG - Exonic
900568948 1:3348960-3348982 CCAGGCCAGCGCTGCCCCGGTGG - Intronic
900730886 1:4258828-4258850 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
900824918 1:4918769-4918791 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
901019402 1:6248310-6248332 CCTGGCCAGGCCTGCACGGGTGG + Exonic
901027599 1:6286884-6286906 CCTCTCCAGCGGTGCCCCTGGGG - Intronic
901989091 1:13097884-13097906 CTTGGCCATCTCTGCCCTGGAGG - Intergenic
901992722 1:13128883-13128905 CTTGGCCATCTCTGCCCTGGAGG + Intergenic
902399721 1:16151250-16151272 CCTGGCCTGCTCTGCCCAGCTGG - Intronic
903378312 1:22880124-22880146 CCTGGCCAGGGGTGCCCAGGAGG + Intronic
903645271 1:24891883-24891905 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG + Intergenic
905451590 1:38060394-38060416 CCTGCCCTGGGCAGCCCCGGGGG - Intergenic
906372993 1:45270197-45270219 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
906381167 1:45332917-45332939 CCTGGCCAGTGCTTCCCTGGAGG - Exonic
906835863 1:49083066-49083088 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
907022833 1:51086052-51086074 CTGGGCCAGTGCTGCCCCTGAGG - Intergenic
907439306 1:54469041-54469063 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
907984237 1:59515116-59515138 CTTGGGCAGCGCTGCCTCTGTGG - Intronic
908004291 1:59712264-59712286 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
909058012 1:70845439-70845461 CTTGGCCAGCTCTGCCTCAGTGG - Intergenic
909065515 1:70931234-70931256 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
909265211 1:73549777-73549799 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
909357437 1:74725991-74726013 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
909579888 1:77222195-77222217 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
909599812 1:77449246-77449268 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
909808763 1:79905459-79905481 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
910001704 1:82349938-82349960 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
910083513 1:83371478-83371500 CTTGGGCAGCTCTGCCCCTGAGG + Intergenic
910166823 1:84337053-84337075 CTTGGACAGCTCTGCCCCTGTGG + Intronic
910233157 1:85007728-85007750 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
910512842 1:88025524-88025546 CTTGGGCAGCTCTGCCCCTGGGG + Intergenic
910727000 1:90349830-90349852 CTTGGGCAGCCCTGCCCCTGTGG - Intergenic
911135018 1:94429996-94430018 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
911267626 1:95761992-95762014 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
911500512 1:98679785-98679807 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
911798968 1:102109976-102109998 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
912017538 1:105060574-105060596 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
912099259 1:106185254-106185276 CCTGGGCAGCTCTGCCCCTGTGG - Intergenic
912136243 1:106662964-106662986 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
912263521 1:108132064-108132086 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
912327763 1:108784971-108784993 CCTAGGCAGCTCTGCCCCTGTGG + Intronic
912405455 1:109434070-109434092 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
912615613 1:111096986-111097008 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
913081794 1:115395180-115395202 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
913709937 1:121472900-121472922 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
914260657 1:145996628-145996650 CCACGCGAGCGCTGGCCCGGAGG + Intergenic
915509139 1:156377117-156377139 GCTGGCCAGCTCTGCGCAGGTGG + Intronic
916477447 1:165183647-165183669 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
916948772 1:169758194-169758216 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
917035398 1:170742757-170742779 CTTGGTCAGCTCTGCCCCTGTGG + Intergenic
917245607 1:172997268-172997290 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
917408719 1:174736403-174736425 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
918049131 1:180959271-180959293 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
918696438 1:187551379-187551401 CGTAGCCAGAGCTGCCCCCGAGG + Intergenic
918787124 1:188776506-188776528 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
919175211 1:194010773-194010795 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
919409627 1:197227549-197227571 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
920373481 1:205493886-205493908 CCTGGCCCAAGCTGCCCAGGCGG + Intergenic
921325322 1:213982762-213982784 CCAGGCCTGCGCTGCCCCCGCGG - Intergenic
921386752 1:214577497-214577519 TCTGGGCAGCTCTGCCCCTGTGG - Intergenic
921466399 1:215492970-215492992 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
922164150 1:223100961-223100983 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
922394066 1:225178021-225178043 CTTGGACAGCTCTGCCCCTGTGG - Intronic
922421735 1:225465118-225465140 TCTGGCCAGCTCTGTCCGGGTGG - Intergenic
922530526 1:226341646-226341668 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
922795109 1:228335918-228335940 ACAGGACAGCGCTGCCCCTGGGG + Intronic
923172306 1:231429163-231429185 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
923698899 1:236281747-236281769 CCTGCCCAGCGCCTGCCCGGCGG + Exonic
1062881273 10:980177-980199 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1063014647 10:2064049-2064071 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1063310276 10:4945616-4945638 CCTGGGCAGCTCTACCCCTGTGG - Intronic
1063982861 10:11470052-11470074 CCTCCACAGCGCTGCCCCGGGGG - Intronic
1064144978 10:12820036-12820058 CCTGGGCCACGCTGCACCGGAGG + Intronic
1064230689 10:13528170-13528192 CCGCCCCAGCCCTGCCCCGGAGG + Intronic
1065347682 10:24764648-24764670 CTTGGGCAGCCCTGCCCCTGTGG + Intergenic
1065456385 10:25910614-25910636 CTTGGGCAGCCCTGCCCCTGTGG - Intergenic
1066062435 10:31736164-31736186 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1066150049 10:32606533-32606555 CCTGGGCAGCTCTGCCCCTGTGG - Intronic
1066636882 10:37511866-37511888 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1067474395 10:46556506-46556528 CCCCGCCTGCGCGGCCCCGGCGG - Intergenic
1067711644 10:48655581-48655603 CCTTCCCAGCGCTGCCCGGCAGG - Intronic
1067812123 10:49438138-49438160 CCTGGCCATCGCTGTCCCTGGGG - Intergenic
1068289992 10:54989458-54989480 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1068523884 10:58106377-58106399 CCTGGCCAGCCCTGCCTGCGGGG - Intergenic
1069173543 10:65262444-65262466 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1069368061 10:67714293-67714315 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1069915534 10:71784535-71784557 CCAGGCCAGGCCTGCCCCTGGGG + Intronic
1070083089 10:73207657-73207679 CCTGGGCAGCTCTACCCCTGTGG - Intronic
1070637692 10:78142321-78142343 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1071818224 10:89253965-89253987 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1074144166 10:110701828-110701850 CCTGGCCAGTGCGGACCCTGGGG - Intronic
1074239378 10:111621919-111621941 CCTAGGCAGCTCTGCCCCTGTGG - Intergenic
1074286202 10:112100443-112100465 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1074737688 10:116453074-116453096 CTTGGGCAGCCCTGCCCCTGTGG - Intronic
1074803973 10:117029061-117029083 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1075265721 10:120998472-120998494 GCTGGCCAGCGCTGCTCCATGGG + Intergenic
1075573795 10:123563739-123563761 CCTGCCCAGCGCTGGCCCTGGGG - Intergenic
1075796531 10:125123929-125123951 CCAGCACAGAGCTGCCCCGGGGG - Intronic
1076310978 10:129507326-129507348 CCAGGCCACCCCTGCCCCAGAGG - Intronic
1076374163 10:129972583-129972605 CCTGGCGAGCACTGCCTGGGAGG - Intergenic
1076763759 10:132619391-132619413 CTTGACCAGCTCTGCCCCTGTGG + Intronic
1076919934 10:133446176-133446198 CCGGGCCAGCCCTGCCCTGGCGG + Intergenic
1077109524 11:855962-855984 GCTGGCCAGCGTGGCCCCCGTGG + Intronic
1077419899 11:2445167-2445189 CCAGGCCCGCGCTGCCCCGCCGG - Exonic
1077580516 11:3414373-3414395 CCTGGCCACCGCTGGACCTGTGG + Intergenic
1077827527 11:5826860-5826882 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1077845211 11:6015591-6015613 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
1077984976 11:7342552-7342574 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1078379652 11:10828877-10828899 CTTGGGCAGCCCTGCCCCTGTGG + Intronic
1079147545 11:17867447-17867469 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1079240854 11:18721298-18721320 CCTGCTCTGCTCTGCCCCGGGGG + Intronic
1079284643 11:19117518-19117540 CCTGGCCAGGGCGCCCCCTGGGG + Intronic
1079559377 11:21803558-21803580 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1079838445 11:25365016-25365038 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1080707729 11:34713674-34713696 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
1080894961 11:36441484-36441506 CCTGGGCAGCTCTGCCCCTGTGG + Intronic
1080959806 11:37145484-37145506 CCTGGGCAACTCTGCCCCTGTGG + Intergenic
1081315515 11:41625213-41625235 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1081628640 11:44671936-44671958 CCTGGGCAGCTCTGCCCCTGTGG - Intergenic
1081939492 11:46928641-46928663 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1082652037 11:55805927-55805949 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1082981959 11:59132096-59132118 CCTGGGCAGCTCTGCCCCTGTGG - Intergenic
1082987040 11:59178065-59178087 CCTGGCCAGGACTGCCCAGGGGG + Intronic
1083272835 11:61580771-61580793 CCAGGTAAGCGCGGCCCCGGCGG - Exonic
1084237447 11:67797202-67797224 CCTGGCCACCGCTGGACCTGTGG + Intergenic
1084482248 11:69428708-69428730 TGTGGCCAGTGCTGCCCTGGGGG + Intergenic
1086309385 11:85519300-85519322 CCTGGGCATCTCTGCCCCTGTGG - Intronic
1086848618 11:91782767-91782789 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1086933771 11:92722394-92722416 CCTGGGCAGCTCTGCCTCTGTGG + Intronic
1087447023 11:98268529-98268551 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1087493788 11:98863722-98863744 CTTGGGCAGCCCTGCCCCTGTGG + Intergenic
1087576899 11:100000464-100000486 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1087777370 11:102268718-102268740 CCTACTCAGCGCTGCCCCGGTGG - Intergenic
1087877529 11:103375529-103375551 CCTGGGCAGCTCTGCCTCTGTGG - Intronic
1088377603 11:109159444-109159466 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
1088426902 11:109714440-109714462 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1088869560 11:113879339-113879361 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1088953798 11:114598265-114598287 CCTGGGCAGCTCTGCCCCTGTGG + Intergenic
1089921335 11:122212370-122212392 CCTGGCCAGAGCAGTGCCGGCGG + Intergenic
1090572941 11:128067925-128067947 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1090630624 11:128644175-128644197 CCTTGCCAGGGCTGCTCTGGAGG + Intergenic
1091293167 11:134453710-134453732 TCTGGCCAGCACTGTGCCGGGGG + Intergenic
1091539746 12:1448947-1448969 CGTGGGCAGCTCTGCCCCTGTGG - Intronic
1091932147 12:4404560-4404582 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1091982671 12:4879166-4879188 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1092046197 12:5433114-5433136 CTTGGCCAGCGCCCACCCGGTGG + Intronic
1092222547 12:6724721-6724743 TGTGGCCAGCGCTGCCCCCTTGG - Exonic
1092408109 12:8234794-8234816 CCTGGCCACCGCTGGACCTGTGG + Intergenic
1092459037 12:8670547-8670569 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1092853025 12:12647962-12647984 CTTGGGCAGCTCTGCCCCTGCGG + Intergenic
1093537344 12:20237786-20237808 CCTGGACAGCTCTGCCCCTGTGG - Intergenic
1093967205 12:25340386-25340408 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
1094495834 12:30988813-30988835 CCTGGCCAGCTCTGCCACAGCGG - Intronic
1095516901 12:43016047-43016069 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1095522644 12:43085583-43085605 CTTGGCCAGCTCTGCCCCTGTGG - Intergenic
1095803396 12:46292779-46292801 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1095978223 12:47954290-47954312 GCTGGCCAGCACCGCCCTGGCGG - Intergenic
1097222843 12:57460914-57460936 GCTGGCTCCCGCTGCCCCGGTGG - Intronic
1097501493 12:60409662-60409684 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1097955743 12:65483817-65483839 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1098319888 12:69232462-69232484 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1098592264 12:72227943-72227965 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1098630976 12:72721059-72721081 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1099396569 12:82147438-82147460 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1099526824 12:83726750-83726772 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1099565933 12:84246391-84246413 CTTGGCCAGCTCTGCCCCTGTGG - Intergenic
1099709041 12:86196397-86196419 CCTGGGCAGCCCTGCCCCTGAGG + Intronic
1099766871 12:86998409-86998431 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1099858994 12:88205384-88205406 CCTGGGCAGCTCTGCCTCTGTGG - Intergenic
1100032434 12:90209434-90209456 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1100054416 12:90491327-90491349 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1100072182 12:90734667-90734689 CTTGGGCAGCTCTGCCCCTGCGG + Intergenic
1100205550 12:92345394-92345416 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1100376155 12:94017937-94017959 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1100427639 12:94501962-94501984 CGTGGGCAGCTCTGCCCCTGTGG + Intergenic
1100433155 12:94548248-94548270 CCAGGCCTGCGCTGCCATGGGGG - Intergenic
1100972011 12:100080310-100080332 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1101877191 12:108603598-108603620 CCTGGCCATGGCTGCCCAGAAGG + Intergenic
1102140944 12:110614292-110614314 GGTGGCCAGGGCTGCCTCGGTGG - Exonic
1102344371 12:112149833-112149855 CCTCACCAGAGCTGCCCAGGAGG + Exonic
1103484581 12:121274098-121274120 CCTCGCCTCGGCTGCCCCGGCGG - Exonic
1104057214 12:125239734-125239756 CCCGGCGAGCGCTGCCGTGGAGG + Intronic
1104172049 12:126291654-126291676 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1104742005 12:131184553-131184575 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1105024872 12:132841327-132841349 CCTGCCCAGCGCTCACCAGGAGG + Exonic
1105817992 13:24054017-24054039 CCTGGACAGCTCTGCCCTGCGGG + Intronic
1106117567 13:26830513-26830535 CCTGGCCAAGGCTTCCCGGGAGG + Intergenic
1106592666 13:31110766-31110788 CCCGGCCAGCTCTGCCCTGTGGG - Intergenic
1106618956 13:31355680-31355702 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1106678378 13:31985045-31985067 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1107961997 13:45566958-45566980 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1108099989 13:46944597-46944619 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1108155835 13:47583988-47584010 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1108184270 13:47873019-47873041 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1109098339 13:58145552-58145574 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1109334160 13:60971426-60971448 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1109344717 13:61100463-61100485 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1109384341 13:61607810-61607832 CCTGGGCAGCTCTGCCCCTAAGG + Intergenic
1109434629 13:62283575-62283597 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1109475613 13:62876935-62876957 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1110028325 13:70571137-70571159 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1110166440 13:72448536-72448558 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1110649418 13:77925902-77925924 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1110793116 13:79606963-79606985 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1110924394 13:81131983-81132005 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1111339323 13:86862910-86862932 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1111419899 13:87998758-87998780 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1111527557 13:89492170-89492192 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1111539281 13:89650206-89650228 CCTGGGCAGCTCTGCCCCTGTGG + Intergenic
1111715802 13:91877379-91877401 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1112259255 13:97863499-97863521 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1112582762 13:100690697-100690719 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1113585390 13:111461036-111461058 CCTGGCGAGCACTGCCTAGGTGG + Intergenic
1113941830 13:114022445-114022467 CGTGGCCAGCCCTACCCAGGGGG + Intronic
1114170780 14:20270829-20270851 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1114991922 14:28298365-28298387 CTTGGCCAGCTCTGCCTCTGTGG - Intergenic
1115289199 14:31751568-31751590 CTTGGCCAGCTCTGCCCCTGTGG + Intronic
1115820372 14:37206689-37206711 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1115919438 14:38355875-38355897 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1116287204 14:42988285-42988307 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1116642788 14:47486158-47486180 CTTGGTCAGCTCTGCCCCTGTGG - Intronic
1116917308 14:50537621-50537643 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1117198442 14:53363946-53363968 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1117256825 14:53986293-53986315 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1117751615 14:58929838-58929860 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1117886792 14:60372249-60372271 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1118388815 14:65279747-65279769 CCTGGCCTGGACTGCCCCGGCGG + Intergenic
1118486044 14:66215364-66215386 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1118691455 14:68344271-68344293 CATGGGCAGCGCTGTCCCTGTGG - Intronic
1118837327 14:69486092-69486114 CCTGTCCAGCCCTTCCGCGGAGG + Intronic
1118952783 14:70449660-70449682 CTTGGGCAGCTCTGCCCCTGCGG + Intergenic
1119187047 14:72650454-72650476 TCAGGCCAGCACTGCCCCGGGGG + Intronic
1119963158 14:78882427-78882449 CTTGGACAGCACTGCCCCTGTGG - Intronic
1120324768 14:83009967-83009989 CCTGGGCAACTCTGCCCCTGTGG - Intergenic
1120485833 14:85112483-85112505 CTTGGCCAGCTCTGCCTCTGTGG + Intergenic
1120799726 14:88675007-88675029 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1120956808 14:90090223-90090245 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1121384726 14:93509692-93509714 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1121483773 14:94298045-94298067 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1121616955 14:95319812-95319834 CCGGGCCAGCGCGGCGCGGGCGG + Exonic
1121640477 14:95481724-95481746 CCAGGCCAGGGCTGCCCCTGTGG + Intergenic
1122027775 14:98889970-98889992 CCTGGCCCGGGTAGCCCCGGAGG + Intergenic
1122392049 14:101396337-101396359 CCTGGCCAGAGCTGCTCCAGGGG - Intergenic
1122604331 14:102938271-102938293 CCTGGCCCCCGCAGCCCTGGGGG - Intronic
1122690039 14:103527947-103527969 CCTGGCCTGGCCTGCCCCAGAGG + Intergenic
1122816122 14:104314912-104314934 CCTGCCCAGCCCTGCCTCTGGGG + Intergenic
1123042926 14:105497806-105497828 CCTGGGCACCTGTGCCCCGGAGG + Exonic
1123060581 14:105592456-105592478 CCTGTCCAGCACTGCCCAGGTGG + Intergenic
1123085059 14:105713427-105713449 CCTGTCCAGCGCTGCCCAGGTGG + Intergenic
1202851628 14_GL000225v1_random:23728-23750 TCTGGCCAGCTCTTCCCTGGTGG - Intergenic
1202853585 14_GL000225v1_random:36725-36747 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202854687 14_GL000225v1_random:43166-43188 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202857099 14_GL000225v1_random:58457-58479 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202858269 14_GL000225v1_random:64556-64578 GCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202859580 14_GL000225v1_random:72842-72864 GCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202862250 14_GL000225v1_random:90132-90154 TCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202921901 14_KI270723v1_random:35033-35055 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202923014 14_KI270724v1_random:2548-2570 TCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1123717472 15:23042056-23042078 CCTGGCCAGAGGTGCCGGGGGGG + Intergenic
1123717572 15:23042382-23042404 CCTGGCCAGAGGTGCCAGGGGGG + Intergenic
1123717643 15:23042609-23042631 CCTGGCCAGAGGTGCTGCGGGGG + Intergenic
1123717991 15:23043800-23043822 CCTGGCCAGAGGTGCTGCGGGGG + Intergenic
1123718664 15:23046158-23046180 CCTGGCCAGAGGTGCCAGGGGGG + Intergenic
1123718697 15:23046270-23046292 CCTGGCCAGAGGTGCTGCGGGGG + Intergenic
1123718869 15:23046865-23046887 CCTGGCCAGAGGTGCTTCGGGGG + Intergenic
1123719463 15:23048913-23048935 CCTGGCCAGAGGTGCTGCGGGGG + Intergenic
1123795669 15:23767489-23767511 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1124109484 15:26773051-26773073 CCGGGCCAGCGCGGCGGCGGCGG - Exonic
1124663232 15:31568215-31568237 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1125273922 15:37970868-37970890 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1125519208 15:40338926-40338948 CCTGCCCAGCACTGCCCATGTGG - Intronic
1126533201 15:49732957-49732979 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1127834949 15:62783408-62783430 CCTCGCCAGCGCAGCCCTGGGGG - Intronic
1128067997 15:64775995-64776017 CCTGGGCGGCCCTGCCCGGGCGG + Intergenic
1130531113 15:84748492-84748514 CCTGGCTGGGGCTGCCGCGGCGG - Intergenic
1130762089 15:86831630-86831652 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1131383896 15:91986679-91986701 CCTGGACAGGGCAGCCCCAGAGG + Intronic
1131724615 15:95207653-95207675 CATGGGCAGCTCTGCCCCTGTGG - Intergenic
1132110831 15:99100665-99100687 CTTGGGCGGCGCTGCCCCAGCGG + Intronic
1132261081 15:100425368-100425390 CCTGGGCAGCTCTGGCCCTGTGG - Intronic
1132466122 16:78126-78148 CGTGGCCCGCCCCGCCCCGGGGG + Intronic
1132588191 16:715235-715257 TCTCACCACCGCTGCCCCGGCGG - Exonic
1132608049 16:801666-801688 CCTGGCCCACGCTTCCCCGGGGG - Intergenic
1132668920 16:1094851-1094873 CCTGGCCCGGGCTGCCCAGGAGG - Exonic
1133349062 16:5089625-5089647 CCTGGCCACCGCTGGACCTGTGG + Intronic
1133509816 16:6446564-6446586 CCTAGCCAGCACTGCCCCCTAGG - Intronic
1134658118 16:15963239-15963261 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1134660532 16:15981113-15981135 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1135918985 16:26631476-26631498 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1136398384 16:30005127-30005149 CCTCCCCAGAGCTGCCCTGGGGG + Intronic
1136662951 16:31781041-31781063 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1136666717 16:31819351-31819373 CCCGGGCTGCGCTTCCCCGGAGG - Intergenic
1136666750 16:31819446-31819468 CCCAGCCAGCGAGGCCCCGGGGG + Intergenic
1136674728 16:31892799-31892821 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1136997277 16:35199020-35199042 TCTCTCCAGCGCTGACCCGGCGG - Intergenic
1137252270 16:46748929-46748951 CCTGCCAAGCGCTGTCCCGAGGG + Intronic
1137446547 16:48535782-48535804 CCTGGGCAGCGCTGCCCCTGGGG + Intergenic
1138123810 16:54422487-54422509 GCAGGCCAGCCCTGCCCCGATGG - Intergenic
1138383887 16:56622737-56622759 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1138654351 16:58482142-58482164 CCTAGCCAGCTCTACCCTGGGGG - Intronic
1139133921 16:64178671-64178693 CCTGGGCAGCTCTGTCCCTGTGG - Intergenic
1139528475 16:67530229-67530251 CCTGGCCAGGCCCGGCCCGGGGG + Intronic
1140036577 16:71375914-71375936 CCAGACCAGAGCTGCCCCGCTGG - Intronic
1140481328 16:75264400-75264422 ACTGGCCAGCCCTGCTCCTGTGG - Exonic
1141741786 16:85898596-85898618 GGTGGCCTGCGCTGCCCGGGAGG - Intergenic
1141906935 16:87033106-87033128 CCACGCCAGGGCGGCCCCGGGGG + Intergenic
1141959209 16:87392877-87392899 ACGGCCCAGCGCGGCCCCGGGGG - Intronic
1142028251 16:87825711-87825733 CCTGGCCAGCACTGTCTCAGGGG - Intergenic
1142215506 16:88827821-88827843 CCTGGCAAGCTCAGCCCCTGGGG + Intronic
1142251587 16:88994298-88994320 CCAGGCCAGCGAAGCCCAGGGGG + Intergenic
1142799766 17:2337781-2337803 CCTGGCCCGCGCGGCCCAGGGGG + Intronic
1142959245 17:3542442-3542464 CCTGGCCAGCAGTGGCCCTGTGG + Intronic
1144497400 17:15757244-15757266 CCTGGTCACCGTGGCCCCGGTGG - Intergenic
1144629192 17:16861728-16861750 CCTGGTCACCGTGGCCCCGGTGG - Intergenic
1146057836 17:29589828-29589850 CCAGGCGAGCGCTGCAGCGGAGG - Intronic
1146098418 17:29954834-29954856 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1146451878 17:32981267-32981289 CTTGGGCAGCTCTGCCCCAGTGG + Intronic
1146452689 17:32987279-32987301 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1146887629 17:36483132-36483154 CCAGGCCCGCACTGCCCGGGTGG - Intergenic
1147834351 17:43319456-43319478 CCTTGGCAGCTCTGCCCCTGTGG + Intergenic
1149189999 17:54050097-54050119 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
1149366849 17:55953445-55953467 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1149470711 17:56913391-56913413 CCAGGCCAGCGCCGACCTGGAGG - Exonic
1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG + Intronic
1150984236 17:70177315-70177337 CCTGGCCAGCACTGCCTAGCAGG - Exonic
1151703879 17:75756870-75756892 CCTGGCCACTCCTGCCCCCGGGG - Intronic
1151714012 17:75822403-75822425 CCTGGCCAGCCCTGCCTCAGAGG - Intronic
1152327232 17:79648598-79648620 CCTGGCCACCTCTGCCTCGTTGG + Intergenic
1152896672 17:82915247-82915269 CCTGGCCGCAGGTGCCCCGGAGG + Intronic
1153317903 18:3742305-3742327 CCTGACCACCGCTGCCCTGACGG + Intronic
1153348298 18:4052017-4052039 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1154178587 18:12108941-12108963 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1154427545 18:14283734-14283756 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1156153119 18:34266745-34266767 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1156243653 18:35276959-35276981 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1156265849 18:35488054-35488076 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1156858799 18:41813420-41813442 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
1156941046 18:42767264-42767286 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1157039986 18:44027491-44027513 CTTGGGCAGCACTGCCCCTGTGG + Intergenic
1157386582 18:47263478-47263500 CCCGGCCCGCGCTGCCCTGCAGG - Intergenic
1159016671 18:63106441-63106463 CCTGGCCAGAGCTGCCAAGCAGG - Intergenic
1159083495 18:63761131-63761153 CTTGGACAGCTCTGCCCCTGTGG - Intronic
1159261271 18:66016093-66016115 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1160573826 18:79837284-79837306 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1160627130 18:80218506-80218528 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1160765218 19:804579-804601 CCTGGCCTTGGCTGCCTCGGCGG + Exonic
1161016936 19:1987809-1987831 CCTGGGCAGCCCCTCCCCGGGGG + Intronic
1161077106 19:2291134-2291156 CCTGGCCATCGCCTCCCTGGAGG - Exonic
1161224406 19:3136393-3136415 CCTGGCCAGCAGGGGCCCGGGGG + Exonic
1161593802 19:5141160-5141182 CCTGCACAGCCCTGCCCAGGTGG - Intronic
1161610030 19:5237392-5237414 CCTGTCCTGGGCCGCCCCGGAGG + Intronic
1161688063 19:5713426-5713448 CCAGGCCAGGGCTGCCCCAGTGG + Intronic
1162302927 19:9854434-9854456 CCTCGCCAGCGCTGCGCTTGGGG + Exonic
1162596560 19:11633939-11633961 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1162737691 19:12755596-12755618 CCTGCCCCGCCCTGCCCAGGTGG + Exonic
1163368663 19:16889875-16889897 CGTGGCCAGCGCTGGCCCTTCGG + Exonic
1163427038 19:17245580-17245602 CCTGGCCGCCGCTCGCCCGGGGG + Exonic
1163556710 19:17997420-17997442 CATGCCCAGAGCTGCCCTGGGGG - Intronic
1164414025 19:28031309-28031331 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1165070285 19:33251525-33251547 CCAGGCCAGGGCAGCCCCGATGG - Intergenic
1165322392 19:35094097-35094119 CCTGCCCAGCCCAGCCCAGGTGG - Intergenic
1166263819 19:41663884-41663906 CTTGGGCAGCCCTGCCCCTGTGG + Intronic
1166406653 19:42526563-42526585 CCTAGTCAGCCCTGCCCAGGAGG + Intronic
1166817189 19:45553422-45553444 CCTTGCCTGCGCTGGCCCAGTGG - Intronic
1166947046 19:46403906-46403928 CCTGGCCAGCGCAGCCACCTGGG - Intergenic
1168073005 19:53963087-53963109 CCCCGCCCCCGCTGCCCCGGTGG + Exonic
1168496272 19:56854186-56854208 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
925122561 2:1430663-1430685 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
925257046 2:2499259-2499281 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
926424937 2:12731897-12731919 CCTGGCCAGCACTGAGCCTGCGG + Intronic
926580955 2:14632758-14632780 CCCGGCCAGCGCAGACCTGGAGG + Exonic
927438161 2:23088357-23088379 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
927714281 2:25342105-25342127 CGGGGCCAGCGCGGCCGCGGGGG - Intronic
927964567 2:27261330-27261352 CCAGGCCAGAGCTTCCCTGGAGG + Intronic
928401128 2:30979506-30979528 CCTGGCCAGAGCTGGCGTGGTGG - Intronic
928474646 2:31614419-31614441 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
928821494 2:35366789-35366811 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
928822068 2:35373220-35373242 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
928897377 2:36281009-36281031 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
928904726 2:36356654-36356676 CCTGGCCTGCGCCGCCCCCTCGG + Intronic
929358175 2:41051116-41051138 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
929452999 2:42048667-42048689 CCTGCCCGGCGGTGCCGCGGTGG + Exonic
929501292 2:42493637-42493659 CCTGCCCTCCGCTGGCCCGGGGG + Exonic
930006838 2:46904458-46904480 CTTGGGCAGCTCTGCCCCTGTGG - Exonic
930076204 2:47407597-47407619 CTTGGACAGCTCTGCCCCTGTGG - Intronic
930089116 2:47519097-47519119 CCTGGCCAGCGCTGCTTCACTGG + Exonic
930254697 2:49076932-49076954 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
930503645 2:52255413-52255435 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
930942075 2:57025498-57025520 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
932493972 2:72137607-72137629 CCTGCCCTGCCCTGCCCCGTGGG + Intronic
932552425 2:72785177-72785199 CTTGGACAGCTCTGCCCCTGTGG + Intronic
933008196 2:77022745-77022767 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
933047647 2:77558568-77558590 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
933181361 2:79230768-79230790 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
933786910 2:85850497-85850519 CCTGGCCAGGCCTGCCCAGCAGG + Intronic
933790822 2:85882443-85882465 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
934960546 2:98668757-98668779 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
935124218 2:100208702-100208724 AGTGGCCAGCGCTGCCCCGGCGG + Intergenic
935385156 2:102492083-102492105 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
935625913 2:105172243-105172265 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
935672592 2:105568589-105568611 CCTACCCAGCGCTGTCCCGTAGG + Intergenic
935792038 2:106601688-106601710 CTTGGGCAGCCCTGCCCCTGAGG + Intergenic
935878377 2:107536353-107536375 GCTGGCCAGCGCTGCCACCCCGG - Intergenic
935898521 2:107764487-107764509 CTTGGGCAGCACTGCCCCAGAGG + Intergenic
936549843 2:113427632-113427654 CTTGGGCAGCTCTGCCCCTGAGG - Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
938137228 2:128769563-128769585 CCTGCCCCGCACTGCCCCAGGGG - Intergenic
938686322 2:133741885-133741907 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
938868798 2:135452743-135452765 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
939278981 2:140038443-140038465 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
939605950 2:144254777-144254799 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
939752365 2:146063759-146063781 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
939754563 2:146093913-146093935 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
940430823 2:153588095-153588117 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
941227171 2:162864785-162864807 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
942283441 2:174390219-174390241 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
942950147 2:181712573-181712595 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
944470267 2:200045580-200045602 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
944800227 2:203231534-203231556 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
944827938 2:203503985-203504007 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
944943026 2:204651487-204651509 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
945122044 2:206467530-206467552 CCTTGGCAGCCCTGCCCCTGTGG + Intronic
945360181 2:208887047-208887069 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
945495224 2:210500656-210500678 CCTTGGCAGCTCTGCCCCTGTGG + Intronic
945593887 2:211768231-211768253 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
945618753 2:212107227-212107249 CTTGGGCAGCTCTGCCCCCGTGG - Intronic
945900722 2:215534446-215534468 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
946874550 2:224114625-224114647 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
946930024 2:224662073-224662095 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
947188041 2:227472361-227472383 GCCGGGCAGCGCTGCGCCGGGGG - Exonic
947951582 2:234152472-234152494 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
947979942 2:234399995-234400017 CCTGGCCAAGGGTGCCCCTGAGG + Intergenic
948104291 2:235400618-235400640 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
948364551 2:237446196-237446218 CATCGCCATCCCTGCCCCGGTGG + Intergenic
948915622 2:241033854-241033876 CCTGGGCTGCGATGCCCCCGAGG - Exonic
948920940 2:241065638-241065660 CGGGGCCAGCGCTGCCCTCGAGG - Intronic
1169000227 20:2163096-2163118 CATGGCCTGAGCTGCCCCTGTGG + Intronic
1169197723 20:3692484-3692506 CTTGGCCAGGGCTGCCCAGGAGG - Intronic
1170152118 20:13236854-13236876 CTTGGGCAGCTCTGCCCCCGGGG + Intronic
1171487613 20:25495646-25495668 CCTGTCCTGAGCTACCCCGGAGG + Intronic
1172775892 20:37406692-37406714 GCTCGCCCGCGCTGCCGCGGCGG + Intergenic
1172777620 20:37416586-37416608 TCTGCCCAGCCCTGCCCCGTAGG - Intergenic
1172794140 20:37525510-37525532 CCAGGCAAGGGCTGCCCTGGTGG + Intronic
1172893128 20:38281215-38281237 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1174564817 20:51457020-51457042 GCCTGCCAGCGCTGCCCCAGGGG + Intronic
1175800042 20:61796367-61796389 ACGGGCCAGGGCTGCCCAGGAGG + Intronic
1175864216 20:62166019-62166041 CCTGGGCAGTGCTGCGCTGGGGG + Intronic
1176687363 21:9862663-9862685 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1176883816 21:14230097-14230119 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1176925568 21:14745190-14745212 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1177017982 21:15815508-15815530 CCTGGGCAGCTCCGCCCCTGTGG - Intronic
1177026274 21:15925293-15925315 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1177197558 21:17919038-17919060 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1177267074 21:18798810-18798832 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1177334711 21:19708107-19708129 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1177473145 21:21584404-21584426 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
1177602728 21:23336465-23336487 CTTGGGCAGCCCTGCCCCAGCGG - Intergenic
1177614371 21:23498805-23498827 CCTGGGCAGCTCTGCCCTTGTGG + Intergenic
1177684481 21:24418704-24418726 CTTGGGCAGCTCTGCCCCAGGGG + Intergenic
1177894547 21:26844432-26844454 CCTCGCCACCGCCGCCCCAGGGG - Exonic
1178002844 21:28182796-28182818 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1178174040 21:30076229-30076251 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1178178524 21:30132627-30132649 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1178221890 21:30669524-30669546 CTTGGGCAGCACTGCCCCTGTGG - Intergenic
1178805697 21:35837333-35837355 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1179065189 21:38018122-38018144 CTTGGACAGCTCTGCCCCTGTGG - Intronic
1179235251 21:39540077-39540099 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1179485965 21:41710962-41710984 CCTGGTGAGTGCTTCCCCGGGGG - Intergenic
1179530320 21:42013990-42014012 CCTGTCCAGTGCTGCCAAGGTGG + Intergenic
1179605632 21:42513788-42513810 CCTGGCCCGCGGGGCGCCGGCGG - Intronic
1179794535 21:43775315-43775337 CCTGGCCTGTGCTCCACCGGAGG + Intronic
1179964246 21:44791887-44791909 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1180009666 21:45040950-45040972 CCTGGCCACTGGTGCCCAGGTGG - Intergenic
1180219735 21:46350883-46350905 CCTGGGCAACGCTGCACCTGGGG - Intronic
1181013074 22:20053579-20053601 TCTGCCCAGCACTGCCTCGGGGG + Intronic
1181130124 22:20726364-20726386 GCTGGGCAGCCCTGCCCCTGAGG + Intronic
1181274870 22:21681947-21681969 GGTGGCCAGCGCTGCTCCAGGGG + Intronic
1183823046 22:40362580-40362602 ACTGGCCAGCCCAGCCCTGGTGG + Intronic
1183847580 22:40554849-40554871 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1184074595 22:42168346-42168368 CCTGGCCAGCTGTGCCCTGAAGG + Intronic
1184650843 22:45918900-45918922 CCTGGCCACCCCTGCCCTGCAGG - Intergenic
1185023608 22:48395053-48395075 CCTGGGCAGCTCAGACCCGGAGG + Intergenic
1185207925 22:49550837-49550859 CCTGGCCAGAGCAGCCCCTACGG + Intronic
949635910 3:5981381-5981403 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
950032907 3:9863697-9863719 CCTGGCCAGCATTGACCCAGGGG - Intergenic
950244954 3:11407324-11407346 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
950472866 3:13197366-13197388 CCTGTCCAGCTCAGCCCCAGTGG - Intergenic
950800804 3:15550590-15550612 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
950828062 3:15846416-15846438 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
950853105 3:16081596-16081618 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
950963415 3:17129050-17129072 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
951192570 3:19787042-19787064 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
951801681 3:26603427-26603449 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
952247152 3:31606900-31606922 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
952605833 3:35145941-35145963 CTTGGGCAGCTCTGCCCCCGTGG + Intergenic
952715017 3:36471770-36471792 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
952901726 3:38115614-38115636 CCTGGCCATGCCTGCCCCTGAGG + Intronic
953685848 3:45077881-45077903 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
953928704 3:46995512-46995534 CCTGGCCATCGCTGTACAGGGGG - Exonic
956290391 3:67654557-67654579 CCCGGCCTGCGCTGCTACGGGGG + Exonic
956412348 3:68992487-68992509 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
956503317 3:69910566-69910588 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
956546315 3:70407628-70407650 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
956938528 3:74131568-74131590 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
957053391 3:75426968-75426990 CCTGGCCACCGCTGGACCTGTGG + Intergenic
957084780 3:75669295-75669317 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
957105588 3:75883349-75883371 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
957113230 3:75992777-75992799 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
957160235 3:76601140-76601162 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
957609927 3:82453227-82453249 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
957870264 3:86082869-86082891 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
957870819 3:86089071-86089093 CTTGGCCAGCTCTGCTCCTGTGG + Intergenic
957949580 3:87107489-87107511 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
958067540 3:88563530-88563552 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
958083782 3:88780332-88780354 CCTGGAAAGCTCTGCCCCTGTGG + Intergenic
958550529 3:95606945-95606967 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
958553255 3:95643214-95643236 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
958646518 3:96881964-96881986 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
958969005 3:100590549-100590571 CCTGGCCATCACTGTCCTGGTGG - Intergenic
959172460 3:102859772-102859794 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
959317093 3:104822291-104822313 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
959507976 3:107176562-107176584 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
959838554 3:110948897-110948919 CTTGGACAGCTCTGCCCCTGAGG + Intergenic
960150702 3:114246007-114246029 CCTGGGCAGCTCTGCCCCTTAGG - Intergenic
960997784 3:123351146-123351168 CCCTTCCAGCGCTGCCTCGGTGG - Intronic
961067739 3:123890650-123890672 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
961301435 3:125924576-125924598 CCTGGCCACCGCTGGACCTGTGG - Intergenic
961659904 3:128463194-128463216 GCAGGCCAGCGCTTCCCCGGAGG - Exonic
961715051 3:128852262-128852284 CCTGGCCAGCATTGACCCAGGGG + Intergenic
961743089 3:129046222-129046244 CCTGGTCTGCGCTGGCCCTGCGG + Intergenic
961887038 3:130103282-130103304 CCTGGCCACCGCTGGACCTGTGG + Intronic
962498634 3:135966499-135966521 CCTGGCCGCCGCCGCCGCGGAGG + Intronic
962576972 3:136763696-136763718 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
963422028 3:145073038-145073060 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
964258267 3:154804666-154804688 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
965066686 3:163858389-163858411 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
965500072 3:169445780-169445802 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
965776997 3:172242155-172242177 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
965931043 3:174043641-174043663 CTTGGCCAGCTATGCCCCTGTGG + Intronic
967154934 3:186683619-186683641 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
968225223 3:196968844-196968866 CCCGGCCCGCCCTGCGCCGGCGG - Intronic
968295196 3:197570998-197571020 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
968479899 4:828681-828703 CCAGGCCAGGGCTGCCCAGCTGG + Intergenic
968516939 4:1019418-1019440 CCTGGCCAGCCCAGCCCCTGTGG - Intronic
968518515 4:1024758-1024780 CCTGGCCAGCACGGCCCGGGAGG - Intronic
968619938 4:1599476-1599498 CCTGTCCAGTGCTGCTCCCGTGG - Intergenic
968879946 4:3293432-3293454 CCTGCCCGGCGCCGCCCCCGCGG - Intronic
968996184 4:3947283-3947305 CCTGGCCACCGCTGGACCTGTGG + Intergenic
969266940 4:6070617-6070639 CATTGCTAGTGCTGCCCCGGGGG - Intronic
969325479 4:6441552-6441574 CCTGGACAGCCCTTCCCTGGCGG + Intronic
969619120 4:8270071-8270093 CCCAGCCCCCGCTGCCCCGGCGG + Exonic
969647511 4:8441042-8441064 CCCGGCCAGGGTTCCCCCGGAGG + Exonic
969757798 4:9161407-9161429 CCTGGCCACCGCTGGACCTGTGG - Intergenic
969817782 4:9698955-9698977 CCTGGCCACCGCTGGACCTGTGG - Intergenic
970222578 4:13825723-13825745 CTTGGGCAGCTCTGCCCCCGGGG - Intergenic
970307916 4:14752278-14752300 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
970635473 4:18005302-18005324 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
970750387 4:19352801-19352823 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
970800383 4:19966189-19966211 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
970977437 4:22057559-22057581 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
970997479 4:22283531-22283553 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
971069914 4:23079831-23079853 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
971277854 4:25215211-25215233 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
971440510 4:26679739-26679761 CTTGGCCAGCTCTGCCCCTGTGG - Intronic
971631529 4:28998952-28998974 CTTGGGCAGCTCTGCCCCCGTGG - Intergenic
971743688 4:30551818-30551840 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
971815131 4:31477228-31477250 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
972057796 4:34826416-34826438 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
972749432 4:41973558-41973580 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
972993657 4:44852589-44852611 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
973213082 4:47637984-47638006 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
973214974 4:47658319-47658341 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
973552308 4:52048181-52048203 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
973758546 4:54097585-54097607 GGTGGGCAGTGCTGCCCCGGGGG + Intronic
974037294 4:56828023-56828045 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
974171412 4:58271068-58271090 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
974271054 4:59651914-59651936 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
976051514 4:81016276-81016298 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
976405544 4:84657810-84657832 CTTGGGCAGCCCTGCCCCTGTGG + Intergenic
977197822 4:94083797-94083819 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
977592536 4:98842480-98842502 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
978153486 4:105464142-105464164 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
979390060 4:120117668-120117690 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
979391841 4:120137850-120137872 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
979839799 4:125423760-125423782 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
980242166 4:130191125-130191147 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
980670133 4:135994495-135994517 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
981400018 4:144302974-144302996 CCTGGGCAGAGCTGCCCTGATGG + Intergenic
982554330 4:156840735-156840757 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
982911168 4:161144492-161144514 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
983083445 4:163415031-163415053 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
983171370 4:164540374-164540396 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
983419565 4:167500478-167500500 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
983713999 4:170754849-170754871 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
983889551 4:173016418-173016440 CTTGGACAGCTCTGCCCCTGTGG - Intronic
984026383 4:174547944-174547966 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
984516946 4:180752791-180752813 CTTGGCCAGCTCTGCCCCTGTGG + Intergenic
984776217 4:183483368-183483390 CCTGGGCAGCGGTGGCGCGGCGG + Intergenic
984811167 4:183797574-183797596 CGCGGCCAGCCCTGCCCTGGGGG + Intergenic
985225086 4:187751368-187751390 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
985551604 5:535960-535982 CCTGGCTCGCCCTGCCCAGGTGG - Intergenic
985692828 5:1323153-1323175 CCTGGCCTCTGCTGCCCAGGTGG - Intronic
986907951 5:12518786-12518808 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
986965617 5:13267401-13267423 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
987191011 5:15478344-15478366 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
987514495 5:18888407-18888429 CGTGGACAGCTCTGCCCCTGTGG + Intergenic
987918512 5:24248412-24248434 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
988038724 5:25860964-25860986 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
988426792 5:31073997-31074019 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
988603045 5:32657001-32657023 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
988858497 5:35252623-35252645 CTTGGTCAGTTCTGCCCCGGTGG + Intergenic
989778063 5:45232823-45232845 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
990125980 5:52518339-52518361 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
990264654 5:54061951-54061973 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
990329647 5:54713199-54713221 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
990595618 5:57309731-57309753 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
990941404 5:61206287-61206309 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
991039241 5:62159079-62159101 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
991116802 5:62964093-62964115 CTTGGGCAGCTCTGCCCCTGCGG + Intergenic
991351186 5:65722107-65722129 TCTGGCCAGCACCGCCCCTGGGG + Exonic
992138151 5:73768390-73768412 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
992375612 5:76185200-76185222 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
992651488 5:78864943-78864965 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
992732810 5:79689799-79689821 CCTCCCCAGCCCTGCCCCTGCGG - Intergenic
992897156 5:81255115-81255137 CGTGGCCATCACTGCCCTGGAGG + Exonic
992924507 5:81567723-81567745 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
993205693 5:84875633-84875655 CCTGGCAAGCCCTGCCACTGTGG + Intergenic
993442373 5:87973010-87973032 CATGGGCAGCTCTGCCCCTGTGG + Intergenic
993517582 5:88857082-88857104 CTTGGACAGCTCTGCCCCTGTGG - Intronic
994019342 5:95005025-95005047 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
994314130 5:98312819-98312841 CCTGGGCAGCCCTGCCTTGGGGG - Intergenic
994655909 5:102593065-102593087 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
994808308 5:104479712-104479734 CTTGGGCAGCCCTGCCCCTGTGG - Intergenic
995113574 5:108454278-108454300 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
995117775 5:108500926-108500948 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
995129344 5:108613171-108613193 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
995147834 5:108806557-108806579 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
995389802 5:111627476-111627498 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
995393107 5:111660857-111660879 CCTGGGCAGCTCTACCCCTGTGG + Intergenic
995590927 5:113699077-113699099 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
996617459 5:125458316-125458338 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
996774687 5:127120870-127120892 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
997102017 5:130980215-130980237 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
997309229 5:132866274-132866296 CCTGGCCAGCGCTGCCCCGGAGG + Intronic
997526497 5:134556206-134556228 TCTGGCCAGCTCTGCCAGGGCGG - Intronic
997585174 5:135039600-135039622 CCTGGGCAGCGCTGCGTCTGCGG + Intronic
998380865 5:141724478-141724500 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
998581805 5:143384698-143384720 CTTGGACAGCTCTGCCCTGGTGG + Intronic
999346036 5:150820412-150820434 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
999458689 5:151739547-151739569 CCAGGCCAGAGCTCCCCCTGTGG + Intergenic
999669311 5:153944867-153944889 CCTGGGCAGCTCCGCCCCCGTGG + Intergenic
1000515510 5:162233146-162233168 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1000522889 5:162319309-162319331 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
1001170661 5:169416197-169416219 CCTGTCCAGCACTGCCCCAGAGG + Intergenic
1001473333 5:172031547-172031569 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1001795569 5:174499307-174499329 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1001906729 5:175479005-175479027 CCTGGCTGCCGCTGCCCCCGAGG - Intronic
1002108355 5:176891433-176891455 ACAGGCCAGCCCTGCCCCTGCGG - Exonic
1002169149 5:177365842-177365864 CCTGGCCGGGGATGCCCAGGTGG + Intronic
1002452958 5:179330201-179330223 CCAGGCCAGCCCAGCCCCAGCGG + Intronic
1002757187 6:172964-172986 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1002892968 6:1352767-1352789 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1003016744 6:2474085-2474107 CCTGAACAGCGCTGGCCAGGAGG + Intergenic
1003062829 6:2876088-2876110 CCGCGCCCGCGCTGCCCCGCGGG - Intergenic
1003078209 6:3000407-3000429 GCTGCCCAGCGCTGCCCTGAAGG + Intronic
1003525463 6:6893137-6893159 ACTGGCCAGCCCAGCCCAGGGGG - Intergenic
1004245689 6:13973039-13973061 CTTGGACAGCCCTGCCCCTGTGG - Intronic
1004515683 6:16320630-16320652 CCTGGGCAGGGCTGTCCCAGCGG + Intronic
1004579768 6:16938925-16938947 CCTGGCCAGCCATGACCAGGAGG - Intergenic
1005329155 6:24732158-24732180 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1005921779 6:30407933-30407955 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1005984073 6:30859662-30859684 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1006271560 6:32970155-32970177 CCTGGCCTGCAGAGCCCCGGTGG + Intronic
1006470435 6:34225757-34225779 CCTGGGCAGCCCTGACCGGGTGG + Intergenic
1007612678 6:43160598-43160620 GCTGGCCAGCATTGCCCCAGAGG + Intronic
1007709230 6:43811329-43811351 CATGGCCAGCTGTGCCCCAGGGG + Intergenic
1008104607 6:47428459-47428481 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1008332683 6:50262213-50262235 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1008650154 6:53553238-53553260 CTTGGGCAGCTCTGCCCCGGTGG - Intronic
1009501475 6:64419749-64419771 CTTGGGCAGCACTGCCCCTGTGG + Intronic
1009669540 6:66729502-66729524 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1009804881 6:68590391-68590413 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1010282657 6:74038821-74038843 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1010515015 6:76762086-76762108 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1010585200 6:77650433-77650455 GCTGGCCAGCGTTTCCCCGCTGG + Intergenic
1010606004 6:77890264-77890286 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1010810359 6:80292981-80293003 CTTGGGCAGAGCTGCCCCTGTGG + Intronic
1010865784 6:80975304-80975326 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1010909491 6:81536257-81536279 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1011152468 6:84289745-84289767 CTTGGGCAGCTCTGCCCCTGCGG + Intergenic
1011343716 6:86346433-86346455 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1011355219 6:86466638-86466660 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1011821269 6:91256142-91256164 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1011844952 6:91552009-91552031 CTTGGACAGCTCTGCCCCTGTGG + Intergenic
1012076253 6:94690774-94690796 CTTGGGCAGCCCTGCCCCTGTGG + Intergenic
1012078618 6:94727371-94727393 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1012148637 6:95718204-95718226 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1012161270 6:95888448-95888470 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1012700468 6:102451068-102451090 CCTGGTCAGCTCTACCCCTGTGG + Intergenic
1012765635 6:103363504-103363526 CCTGGACAGCTCTGCCCCTGTGG - Intergenic
1013149113 6:107426651-107426673 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1013156096 6:107491470-107491492 CCAGGCCAGCGGTGCACCAGAGG + Intronic
1013422573 6:109979451-109979473 CCTGGCCACCGCTGACCTGTTGG + Exonic
1014068081 6:117150407-117150429 CTTGGCCACCTCTGCCCCTGTGG + Intergenic
1014883011 6:126746259-126746281 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1015053851 6:128875610-128875632 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1015110654 6:129588505-129588527 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1015548316 6:134385524-134385546 CCTGGGCAGCATTGCCCCGTGGG + Intergenic
1015667768 6:135650786-135650808 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1015901805 6:138075378-138075400 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1016094583 6:140020159-140020181 CTTGGTCAGCTCTGCCCCTGTGG + Intergenic
1016177641 6:141099557-141099579 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1016592927 6:145766213-145766235 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1016728898 6:147406943-147406965 CCTGGGGGGCGCTGCGCCGGTGG - Intergenic
1017231421 6:152077620-152077642 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1017342101 6:153336017-153336039 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1018482482 6:164205750-164205772 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1018866840 6:167753014-167753036 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1018964712 6:168475542-168475564 CATGGCCAGCGTTGCCTTGGGGG + Intronic
1019050574 6:169179982-169180004 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1019151221 6:170007234-170007256 GCTGCCCAGGGCTGCCTCGGTGG - Intergenic
1019274096 7:166837-166859 CCAGGCCACCGCTGCCCCCCAGG + Intergenic
1019606840 7:1914158-1914180 CCTGGCCAGTGCTGGCCTGGAGG + Intronic
1019635317 7:2072390-2072412 GCTGGCCAGTGCTGCACCTGGGG - Intronic
1020083159 7:5297120-5297142 CCAGGCCTGGCCTGCCCCGGTGG - Exonic
1020275516 7:6622340-6622362 CACGGCCGGCGCTGCCACGGCGG - Exonic
1020542168 7:9471291-9471313 CCTGGACAGCTCTGCCCCTGTGG - Intergenic
1021096387 7:16540149-16540171 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1021750632 7:23795677-23795699 CTTGGGCAGCTCTGCCCCAGTGG - Intronic
1021787211 7:24164166-24164188 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1021882927 7:25111479-25111501 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1022112399 7:27239661-27239683 CCAGGCCAGCCCAGCCCCGGCGG + Intergenic
1022410339 7:30135014-30135036 CCGGCCCAGCCCGGCCCCGGAGG + Exonic
1022492830 7:30833939-30833961 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1022559904 7:31336828-31336850 CCTGGCCAACGCTGCCCCTCGGG - Intergenic
1022705945 7:32802191-32802213 CTTGGGCAGCCCTGCCCCTGTGG + Intergenic
1023059739 7:36315895-36315917 CCTGGCCTGCAGTGGCCCGGTGG - Intergenic
1023745794 7:43321207-43321229 TCTGGCCACAGCTCCCCCGGAGG + Intronic
1024137873 7:46429437-46429459 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1024308864 7:47950815-47950837 CCAGCCCAGCGCTGGCCCCGAGG - Intronic
1024383469 7:48725153-48725175 CTTGCCCAGCTCTGCCCCTGTGG + Intergenic
1024471682 7:49773526-49773548 CTTGGCCCGCGCTGCCCCGGGGG - Intergenic
1024814907 7:53257163-53257185 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1025211124 7:57020067-57020089 CCAGGCCTGGCCTGCCCCGGCGG + Intergenic
1025660831 7:63556780-63556802 CCAGGCCTGGCCTGCCCCGGCGG - Intergenic
1025769979 7:64495297-64495319 CCTGGCCTGGGCGACCCCGGGGG + Intergenic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1026096710 7:67352197-67352219 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1026120062 7:67529201-67529223 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1026188836 7:68105865-68105887 CCTGGCCATTGCTGCCCAGTGGG - Intergenic
1027180360 7:75935123-75935145 CCTGGGCAGCTCTGTCCTGGTGG - Intronic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1027300344 7:76827619-76827641 CTTGGGCAGCTCTGCCCCTGAGG + Intergenic
1027605299 7:80292363-80292385 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1027624817 7:80532403-80532425 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1028253167 7:88559286-88559308 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1028668290 7:93372103-93372125 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1030381231 7:108813827-108813849 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1030459108 7:109808406-109808428 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1030559044 7:111062847-111062869 CTTGGACAGCTCTGCCCCTGTGG + Intronic
1030826876 7:114169302-114169324 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1031618200 7:123905418-123905440 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1031652117 7:124303788-124303810 CCTGGGCAGCTCTGTCCCTGTGG - Intergenic
1031703859 7:124958637-124958659 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1032012724 7:128357451-128357473 CCTGGCCAGCGCTGTCACCAAGG + Intronic
1033256239 7:139804142-139804164 CCTGGGCAGCTCTGCCTCTGTGG - Intronic
1033735224 7:144215223-144215245 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1033747832 7:144335746-144335768 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1033998681 7:147385646-147385668 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1034510641 7:151531953-151531975 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1034904741 7:154934215-154934237 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1034976927 7:155454262-155454284 CCTGGCCAGCCCTGCGCCCTCGG - Intergenic
1035171852 7:157021529-157021551 CCCGGCCACAGGTGCCCCGGCGG + Intergenic
1035261980 7:157667748-157667770 CCTGACAAACGCTGCCCCGTGGG - Intronic
1035605332 8:926635-926657 CCTGGCCACGGCCGCCCAGGCGG - Intergenic
1036381054 8:8236735-8236757 CCTGGCCAGCGCTGGACCTGTGG - Intergenic
1036773249 8:11592928-11592950 CCAGGCCAGCGCCGCCCGGCCGG + Intergenic
1036848519 8:12185893-12185915 CCTGGCCACCGCTGGACCTGTGG + Intronic
1036869879 8:12428174-12428196 CCTGGCCACCGCTGGACCTGTGG + Intronic
1037415876 8:18649255-18649277 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1037517336 8:19645830-19645852 CCAGGCCAGCACTGCCCTGGGGG - Intronic
1037822304 8:22140889-22140911 CCTGCCCAGGCCTGCACCGGTGG + Intronic
1037979054 8:23237703-23237725 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1038002653 8:23404296-23404318 CCTGGGAAGGGCTGCCCCGCAGG - Intronic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1041852132 8:62403950-62403972 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1042164940 8:65936032-65936054 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1042622004 8:70717094-70717116 CCTTGGCAGCTCTGCCCCTGTGG + Intronic
1043065669 8:75567569-75567591 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1043317442 8:78939326-78939348 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1043345873 8:79297098-79297120 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1044152726 8:88801170-88801192 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1044324779 8:90847343-90847365 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1044538174 8:93381388-93381410 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1044660455 8:94590188-94590210 GCTGGCGAGCGCCGCCCGGGAGG + Intergenic
1044665446 8:94629967-94629989 TCTGGCCAGCGCTGCCCCCCGGG - Intergenic
1045207480 8:100057018-100057040 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1045214109 8:100129881-100129903 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1045564490 8:103299191-103299213 CCTGGCCTGCGCGGCGCCGCGGG - Intronic
1045675926 8:104607922-104607944 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1046107476 8:109683280-109683302 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1046786423 8:118271841-118271863 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1046889015 8:119400841-119400863 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1047194979 8:122712982-122713004 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1047463552 8:125091539-125091561 CGTGGCCAGCGCGGCCCAGCGGG + Intronic
1047937689 8:129798327-129798349 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1048694701 8:137012904-137012926 CCTGGGCACCTCTGCCCCTGTGG + Intergenic
1049406460 8:142453757-142453779 CCTGACCAGCTCTGCCAAGGAGG + Intronic
1049436648 8:142589238-142589260 CCTGGCCAGCACTGCCCGGGGGG - Intergenic
1049459934 8:142721848-142721870 CCTGGACAGTGCTACCCCAGGGG + Intergenic
1049571593 8:143372511-143372533 CCAGCCCAGCCCTGCCCCCGTGG - Intronic
1049746565 8:144265629-144265651 CCTGGGGACCGCTGCCCAGGAGG + Intronic
1049903101 9:189195-189217 CTTGGGCAGCTCTGCCCCTGAGG + Intergenic
1050674466 9:8036544-8036566 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1050928980 9:11300851-11300873 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1051041516 9:12817956-12817978 CGTGCCCAGCGCTCCCACGGTGG + Intronic
1051364880 9:16314825-16314847 TTTGGCAGGCGCTGCCCCGGAGG - Intergenic
1051743833 9:20276430-20276452 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1051767394 9:20540133-20540155 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1052051198 9:23851120-23851142 CCTACTCAGCGCTGCTCCGGAGG + Intergenic
1052173776 9:25432513-25432535 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1052210125 9:25893884-25893906 CTTGGGCAGCTCTGCCCCTGAGG + Intergenic
1052985596 9:34484925-34484947 CCTGGCCACCTCTGCCCTGGGGG - Intronic
1053174139 9:35910081-35910103 CCTAGCCAGCGCTGGCCCTCCGG - Intergenic
1053746118 9:41199477-41199499 CTTGGGCAGCTCTGCCCCTGAGG + Intergenic
1053781939 9:41618939-41618961 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1054169889 9:61829093-61829115 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1054481152 9:65665740-65665762 CTTGGGCAGCTCTGCCCCTGAGG - Intergenic
1054667649 9:67751722-67751744 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1054682227 9:68231803-68231825 CTTGGGCAGCTCTGCCCCTGAGG - Intergenic
1055080753 9:72265868-72265890 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1055372876 9:75619416-75619438 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1055384688 9:75748154-75748176 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1055579243 9:77690756-77690778 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1057024505 9:91724999-91725021 CCTGTTCGGCCCTGCCCCGGGGG - Exonic
1057045997 9:91886599-91886621 CCCGGCCCGGGCTGCTCCGGAGG + Intronic
1057716812 9:97502026-97502048 CCTGGCCAGGGCTGCGCGCGCGG - Intronic
1057905600 9:98980608-98980630 CCTGGTCAGCCCTGGCCCTGAGG + Intronic
1058174593 9:101722576-101722598 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1059562370 9:115347800-115347822 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1060449442 9:123723047-123723069 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1061083728 9:128387176-128387198 TCTGGCCACCGCTGGCGCGGAGG + Intronic
1061095800 9:128456288-128456310 TCTCGCCCGCGGTGCCCCGGAGG - Intronic
1061187457 9:129063185-129063207 CCTGCCCAGCGATGCCCCGGGGG - Intronic
1061272342 9:129550438-129550460 CCGGGCCAGGGCCGCCCAGGAGG - Intergenic
1061307959 9:129743249-129743271 CCTGGCCACTGCGGCCTCGGAGG - Intronic
1061488764 9:130933889-130933911 CCTGGCCTGGCCTCCCCCGGAGG - Intronic
1061666078 9:132161795-132161817 TCTGGCCCGCGCCGCGCCGGGGG + Intronic
1061793113 9:133068903-133068925 CCTCGCCAGTGCTTTCCCGGCGG - Intronic
1061795716 9:133084687-133084709 CCTCGCCAGTGCTTTCCCGGCGG - Intronic
1061859364 9:133460246-133460268 CCTGCCCCGCCCCGCCCCGGCGG + Intronic
1062353167 9:136148947-136148969 CCTGGCCTCAGCTGCCCTGGGGG - Intergenic
1062363935 9:136200025-136200047 AGTGGGCAGCTCTGCCCCGGCGG - Intronic
1062374998 9:136258103-136258125 CCTGAACAGCGCAGGCCCGGAGG + Intergenic
1062413178 9:136434820-136434842 CCTGGCCAGCGGGGCCCTGTTGG - Exonic
1062618024 9:137406909-137406931 CCTGGCTGGGGCTGCCCCGTCGG - Intronic
1062689694 9:137834875-137834897 TCAGGCCAGCGCGGCCCAGGAGG + Exonic
1202782248 9_KI270718v1_random:10250-10272 CTTGGGCAGCTCTGCCCCTGAGG + Intergenic
1185615693 X:1420501-1420523 CTCGGCCAGCGCTGCCAAGGAGG + Intronic
1185893333 X:3838586-3838608 CCCGGCCAGCGCTGGGGCGGTGG - Intronic
1185898447 X:3877010-3877032 CCCGGCCAGCGCTGGGGCGGTGG - Intergenic
1185903562 X:3915439-3915461 CCCGGCCAGCGCTGGGGCGGTGG - Intergenic
1186221833 X:7357073-7357095 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1188041764 X:25376836-25376858 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1188166448 X:26870186-26870208 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1188773900 X:34189376-34189398 CATGGGCAGCTCTGCCCCTGTGG + Intergenic
1188865222 X:35305758-35305780 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1189011402 X:37049073-37049095 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1189431334 X:40950208-40950230 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1189435681 X:40990787-40990809 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1189604290 X:42660158-42660180 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1189815834 X:44823375-44823397 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1189945259 X:46171210-46171232 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1190214921 X:48473706-48473728 CCAGGCCAGCTCTTTCCCGGTGG - Intergenic
1190513229 X:51195361-51195383 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1190950677 X:55140028-55140050 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1191095122 X:56665554-56665576 CCTGGGCAGCTCTACCCCTGTGG - Intergenic
1191116371 X:56857445-56857467 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1191606847 X:63071819-63071841 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1191694815 X:63978777-63978799 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1192378372 X:70587851-70587873 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1193422167 X:81294809-81294831 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1193455802 X:81729985-81730007 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1193801955 X:85946890-85946912 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1193865881 X:86729129-86729151 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1193891022 X:87046109-87046131 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1193962910 X:87947600-87947622 CTTGGACAGCTCTGCCCCTGTGG - Intergenic
1194042798 X:88962639-88962661 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1194084128 X:89505434-89505456 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1194211967 X:91081475-91081497 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1194332529 X:92600830-92600852 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1194625936 X:96227095-96227117 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1194756364 X:97743687-97743709 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1194877020 X:99201569-99201591 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1194886174 X:99318593-99318615 CTTGGTCAGCTCTGCCCCTGTGG - Intergenic
1194982382 X:100453607-100453629 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1195072146 X:101291398-101291420 GCTGGGCAGCGCGGCCGCGGAGG - Intronic
1195243153 X:102972920-102972942 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1195457420 X:105084370-105084392 CTTGGGCAGCTCTGCCCCAGTGG - Intronic
1195510765 X:105713045-105713067 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1195545302 X:106106510-106106532 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1195822141 X:108956891-108956913 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1195823612 X:108973083-108973105 CTTGGGCAGCGCCGCCCCTGTGG - Intergenic
1196168867 X:112565417-112565439 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1196368235 X:114946850-114946872 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1196522269 X:116687477-116687499 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1197092616 X:122556551-122556573 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1197400041 X:125979134-125979156 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1197464338 X:126784472-126784494 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1197914631 X:131521387-131521409 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1197975726 X:132163759-132163781 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1198569832 X:137942716-137942738 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1198804022 X:140475721-140475743 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1198912882 X:141633945-141633967 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1198913348 X:141638199-141638221 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1199027831 X:142960882-142960904 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1199041409 X:143119281-143119303 CATGGGCAGCTCTGCCCCTGTGG + Intergenic
1199309992 X:146311146-146311168 CTTGGCAAGCTCTGCCCCTGTGG + Intergenic
1199476794 X:148254897-148254919 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1199480974 X:148298018-148298040 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1199515201 X:148668219-148668241 CTTGGACAGCTCTGCCCCTGTGG + Intronic
1199619472 X:149686381-149686403 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1199687033 X:150273795-150273817 CTTGGGCAGCTCTGCCCCTGTGG - Intergenic
1200060223 X:153480724-153480746 CCAGGCCAGGGCTGGCCCTGAGG + Intronic
1200114679 X:153764938-153764960 CCAGCCCAGCCCTGCCCCTGGGG - Intronic
1200332266 X:155310487-155310509 CTTGGGCAGCTCTGCCCCTGTGG + Intronic
1200353810 X:155526710-155526732 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1200436771 Y:3161320-3161342 CTTGGGCAGCTCTGCCCCTGTGG + Intergenic
1200615015 Y:5368797-5368819 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1200641229 Y:5719882-5719904 CTTGGGCAGCTCTGCCCCTGTGG - Intronic
1201175670 Y:11307281-11307303 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic