ID: 997309900

View in Genome Browser
Species Human (GRCh38)
Location 5:132871055-132871077
Sequence TTTTGCTGTCCCTAAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997309900_997309904 15 Left 997309900 5:132871055-132871077 CCTCCTGCTTAGGGACAGCAAAA No data
Right 997309904 5:132871093-132871115 CCAACTCCTAGTGATCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997309900 Original CRISPR TTTTGCTGTCCCTAAGCAGG AGG (reversed) Intergenic
No off target data available for this crispr