ID: 997310853

View in Genome Browser
Species Human (GRCh38)
Location 5:132880957-132880979
Sequence CCTAGTCGACACTAAGAATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997310853_997310858 24 Left 997310853 5:132880957-132880979 CCTCATTCTTAGTGTCGACTAGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 997310858 5:132881004-132881026 CGTGATGTGACACAGTGTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 92
997310853_997310856 -10 Left 997310853 5:132880957-132880979 CCTCATTCTTAGTGTCGACTAGG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 997310856 5:132880970-132880992 GTCGACTAGGTGGTATGTTATGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997310853 Original CRISPR CCTAGTCGACACTAAGAATG AGG (reversed) Exonic
909972302 1:82005171-82005193 CCCAGTTCACACTGAGAATGGGG + Intergenic
1063331189 10:5161186-5161208 CCTACTCGTCACTAAGAATGAGG + Intergenic
1063393924 10:5669019-5669041 CCTAGAAGACTCTAAAAATGTGG - Intergenic
1085704459 11:78773817-78773839 CCTAGTAGACCCTCAGTATGTGG - Intronic
1088157967 11:106831910-106831932 CCTCCTCCATACTAAGAATGTGG + Intronic
1089646275 11:119881279-119881301 CCTAGTCACCACTAGGAAGGGGG - Intergenic
1096570052 12:52517507-52517529 CCATGACGACACTAAGAATGGGG - Intronic
1105674009 13:22650651-22650673 CCTTGTGGACACTAAAAATTAGG + Intergenic
1109526323 13:63580610-63580632 CCTAGGCTACACACAGAATGGGG + Intergenic
1112997424 13:105591028-105591050 CTTAGTCCACATTAAAAATGAGG + Intergenic
1148579078 17:48730699-48730721 CCTAGTGGAAACTAAAACTGTGG - Intergenic
1159038500 18:63299992-63300014 CCCAGTAGGCACAAAGAATGTGG + Intronic
928572777 2:32625838-32625860 CATATTCAAGACTAAGAATGAGG - Intergenic
930390263 2:50751937-50751959 CCTAGTGAACAGTAAGAATCAGG + Intronic
936650486 2:114420968-114420990 CATAGTAGACACTAAGAAAATGG - Intergenic
942122454 2:172791870-172791892 CCTAGTCTACACTCCTAATGTGG + Intronic
1171265467 20:23768245-23768267 CCTAGCTGACACTAAAAAAGAGG + Intergenic
950353349 3:12379542-12379564 CCTAGACAGCACTAAGAAGGTGG + Intronic
976285503 4:83366960-83366982 CCTCTTCGACAATAAGAAGGAGG - Intergenic
978854323 4:113376096-113376118 CCTAGTGAACACTAGGCATGTGG - Intronic
979306371 4:119149213-119149235 CGTAGTCTTCACTAAGACTGCGG + Intronic
983911114 4:173240662-173240684 CCCAGCCGAAACTAAGACTGGGG + Intronic
987581503 5:19799749-19799771 ACTAGTTGACACTGAAAATGAGG + Intronic
992707591 5:79412748-79412770 ATTAGTTGACACAAAGAATGAGG + Intronic
997310853 5:132880957-132880979 CCTAGTCGACACTAAGAATGAGG - Exonic
1009671015 6:66750122-66750144 CCTATTTGACAGTAACAATGGGG + Intergenic
1019330457 7:458290-458312 CCTGCTGGACACTAAGGATGGGG + Intergenic
1021645772 7:22788162-22788184 CCTAGTAGACTGTCAGAATGAGG + Intergenic
1036476026 8:9094316-9094338 CCAAGTCTGCACTGAGAATGAGG - Intronic
1041258004 8:55995825-55995847 CCGAGTGGAAACAAAGAATGTGG - Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1053341660 9:37341193-37341215 CCTACTTCACACTGAGAATGTGG - Intronic
1056769201 9:89464735-89464757 CCTAATGGACCCAAAGAATGAGG - Intronic
1195623743 X:106986079-106986101 CCTTGTCTTCACCAAGAATGGGG - Exonic