ID: 997313155

View in Genome Browser
Species Human (GRCh38)
Location 5:132907312-132907334
Sequence TGGGAAGTTCTATGAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997313155_997313158 1 Left 997313155 5:132907312-132907334 CCTATTTTTCATAGAACTTCCCA 0: 1
1: 0
2: 2
3: 28
4: 285
Right 997313158 5:132907336-132907358 TGACTCTTTGTTTTTTCCTAAGG 0: 1
1: 0
2: 2
3: 38
4: 540
997313155_997313160 21 Left 997313155 5:132907312-132907334 CCTATTTTTCATAGAACTTCCCA 0: 1
1: 0
2: 2
3: 28
4: 285
Right 997313160 5:132907356-132907378 AGGATGAAACCCAAACTCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997313155 Original CRISPR TGGGAAGTTCTATGAAAAAT AGG (reversed) Intronic
900735040 1:4294367-4294389 TGGGAAAGTCAATGAAACATTGG - Intergenic
901033912 1:6324840-6324862 TGGGACCTTATATGGAAAATGGG - Intronic
901053586 1:6438086-6438108 TGTGAAGTCCTGTGAAGAATTGG + Intronic
901231409 1:7643499-7643521 TGGGCAGCTCCAGGAAAAATGGG - Intronic
901565403 1:10110049-10110071 TGGGAAGATCAATGAGAAAGGGG - Intronic
904267619 1:29326633-29326655 TGGGAAGGTCTCTTTAAAATGGG + Intronic
905312366 1:37058745-37058767 TGACAAGTTCTCTGAAGAATAGG - Intergenic
906819477 1:48914004-48914026 TGGGAAGTTGGAGGAAAGATTGG + Intronic
906868828 1:49453364-49453386 TGGGTAGTTCTATTAAATCTGGG - Intronic
907045838 1:51299571-51299593 TGAGGACTTCTGTGAAAAATGGG - Intronic
907517173 1:55000100-55000122 TGTGAAGCTCTGTGGAAAATAGG - Intronic
907681464 1:56568133-56568155 TGGGAAGGTGGAGGAAAAATGGG + Intronic
910043131 1:82878241-82878263 TGGGAAGTGCTATGCTAATTAGG + Intergenic
910059389 1:83070245-83070267 AGGGAAGATTTATTAAAAATAGG + Intergenic
910079820 1:83328207-83328229 AGGTAAGTTCTATGAAACAAAGG - Intergenic
911116590 1:94251935-94251957 TGTTAAGTTCTATGAAAGAAGGG + Intronic
911470330 1:98310204-98310226 TGGTAGGTTCTATGAAAGAGCGG - Intergenic
914395019 1:147257833-147257855 TGAGAAGTTCTCTTAAAAAGAGG - Intronic
916183599 1:162109677-162109699 TGAAAAGTTCTATGTAAAATGGG + Intronic
916598763 1:166272142-166272164 CTGTAAGTTCTATGAAAAAAAGG - Intergenic
918155719 1:181844565-181844587 TGGGAAGAGATATGAACAATTGG + Intergenic
919948854 1:202343709-202343731 TGGGTGGTTCTCTGAGAAATAGG + Intergenic
920748456 1:208651318-208651340 TGAGAAATTCTGTGAGAAATTGG + Intergenic
920794211 1:209123214-209123236 TGGTCACTTCTATGGAAAATTGG + Intergenic
921907784 1:220513566-220513588 TGTGAAGTTGTCTGTAAAATGGG - Intergenic
922585161 1:226728779-226728801 TAGCAAGCTCTCTGAAAAATGGG - Intronic
923058450 1:230448095-230448117 TGGGAAGTTGAGTGAGAAATGGG - Intergenic
923183403 1:231546053-231546075 TGAGAAGTGCTATGAAAAAAGGG - Intronic
923217988 1:231867696-231867718 TGGGAAGATCTATCAACAACAGG - Intronic
1064562046 10:16603240-16603262 TAGCAAGCTATATGAAAAATAGG + Intronic
1065434012 10:25687957-25687979 TGTGAAGTCCTATGAAAGAATGG - Intergenic
1066665302 10:37777084-37777106 TGGGATGTGCTATACAAAATGGG + Intronic
1067489353 10:46683883-46683905 AGGGATATTCTATGAAAAAGTGG - Intergenic
1067605317 10:47656502-47656524 AGGGATATTCTATGAAAAAGTGG + Intergenic
1068241635 10:54309196-54309218 TGGGACTTTCTATGGCAAATGGG + Intronic
1068418848 10:56762881-56762903 AGGGTAGGTATATGAAAAATAGG - Intergenic
1068582875 10:58762342-58762364 TGGGAATGTCTGTGAAATATTGG + Intronic
1068885607 10:62093442-62093464 TGGAGAGTTTTATGAAAAAGAGG - Exonic
1071620877 10:87117898-87117920 AGGGATATTCTATGAAAAAGTGG + Intronic
1072019469 10:91383792-91383814 TGGGAAGTTCTTTGAAAGTTTGG + Intergenic
1072266292 10:93731195-93731217 TTGGAAGTTTCATGAAAATTCGG - Intergenic
1073090190 10:100930675-100930697 GGGGAAGTACTTTAAAAAATTGG - Intronic
1073604312 10:104878835-104878857 TTGGATGTTCTAGGAAACATAGG + Intronic
1075264500 10:120989177-120989199 AGGGTAGGTCTATGTAAAATAGG - Intergenic
1075443839 10:122500285-122500307 TGGGGAGTTGTATGAAAAAGGGG + Intronic
1076281889 10:129253377-129253399 TGGGAAATTCCATGAGAAAAAGG + Intergenic
1077552937 11:3209907-3209929 TGTGAACTTCTATGACAAAAGGG - Intergenic
1077940909 11:6841968-6841990 TGGGCAGTCCTTTAAAAAATAGG - Intergenic
1079625709 11:22614684-22614706 TTGGAAGATCTAGAAAAAATGGG - Intergenic
1079710023 11:23670723-23670745 GAGGAAGTTCTATGAAAGATTGG + Intergenic
1079926171 11:26494582-26494604 TGTGAATTTTTAAGAAAAATGGG - Intronic
1080285220 11:30603501-30603523 TGGTAAGTGCTATAAAAAAAAGG - Intergenic
1080430861 11:32198393-32198415 TGGTTAGTTCTCTGAAAGATGGG - Intergenic
1080709408 11:34732428-34732450 AGGTAACATCTATGAAAAATGGG + Intergenic
1080759134 11:35230775-35230797 TTGGAAGTTCTAGGACCAATCGG - Intronic
1081130601 11:39374288-39374310 TGCCAATTTCTATAAAAAATGGG - Intergenic
1081634781 11:44713906-44713928 TCCTAAGTGCTATGAAAAATAGG + Intergenic
1082102234 11:48182193-48182215 TGGGAAGTTCTTGGAAAATTTGG + Intergenic
1082712518 11:56570143-56570165 TGGGAAGTTCTCTGGAACATAGG + Intergenic
1083466746 11:62852206-62852228 TGGGAAGTTCAATCAACAATTGG + Intergenic
1084054488 11:66623634-66623656 TGGGAAGTACTGTGAAAAAGCGG + Intronic
1084655309 11:70511800-70511822 AGGGAATTTCTGTGAAGAATGGG + Intronic
1085890836 11:80577042-80577064 TGAGAATTTTTATGATAAATCGG - Intergenic
1086464088 11:87036207-87036229 TGGGAAGTTTTTTTAAAAACAGG + Intergenic
1087155536 11:94898321-94898343 TGGGCAGTTCTATCAAAAGATGG + Intergenic
1087356822 11:97104011-97104033 TGGGAAGTTATATGAAGTTTGGG + Intergenic
1087886765 11:103491248-103491270 AGGGTAGGTCTATGTAAAATAGG + Intergenic
1088972214 11:114783544-114783566 CTGGAAGTTCTGTGAAAAGTTGG + Intergenic
1089907560 11:122058066-122058088 TGTCAAGTTCTTTGAAGAATAGG - Intergenic
1090486559 11:127117676-127117698 TGGAATGTGCTATGAAACATAGG - Intergenic
1092552448 12:9517895-9517917 TTTGCAATTCTATGAAAAATTGG - Intergenic
1092692762 12:11132152-11132174 TGGGAAGTTCTATTATAAGAAGG - Intronic
1093366517 12:18306196-18306218 TGGGAAGTCTTAAGAAAAATAGG + Intronic
1094411881 12:30175627-30175649 TGGGCTGTTCTAGGAAAGATGGG - Intergenic
1094519673 12:31172717-31172739 TTTGCAATTCTATGAAAAATTGG + Intergenic
1094627851 12:32141780-32141802 TGGTAAGTGCTATTCAAAATGGG - Intronic
1095338142 12:41054385-41054407 TGTTATGTTCCATGAAAAATAGG - Intronic
1095560237 12:43555553-43555575 TGGGAAGTCTTTTGAAAACTAGG + Intergenic
1095828589 12:46558067-46558089 TGGGAAGATATATGAAAGAAGGG + Intergenic
1099458244 12:82891246-82891268 TGAGATGTTTTATTAAAAATTGG + Intronic
1099733245 12:86533314-86533336 TAGAAAGTTGTTTGAAAAATGGG - Intronic
1099980962 12:89601975-89601997 TGGAAAGTTCTATGAAATATGGG + Intronic
1100365464 12:93916225-93916247 TGGAAAGTTTAATGAAGAATAGG + Intergenic
1100422096 12:94444956-94444978 TGTTAATTTCTATGAAAACTTGG - Intronic
1101572194 12:105963956-105963978 TGGAAAGATCTATAAATAATAGG + Intergenic
1105240276 13:18601577-18601599 GGGGAATTTCTATGAAGAAGAGG - Intergenic
1105424048 13:20278951-20278973 AGGGAAGGTCTAGGAAAAAGAGG + Intergenic
1106861129 13:33909927-33909949 TGGGAAGGTCTATCATAAAAAGG + Intronic
1107250763 13:38359041-38359063 TGGTAAGTTCTATGGAATATAGG - Intronic
1108301418 13:49080712-49080734 TGTGAAGAGTTATGAAAAATAGG + Intronic
1108861265 13:54862341-54862363 TTGGAACTCCTGTGAAAAATAGG - Intergenic
1108930440 13:55811351-55811373 TTGAAGGTTTTATGAAAAATTGG - Intergenic
1110123519 13:71912753-71912775 AAGGAAGATCTAAGAAAAATGGG + Intergenic
1110457566 13:75707317-75707339 TGGGAAAGTTTATGAAAAATTGG - Intronic
1110945514 13:81410483-81410505 TGAGAATTTCTATCATAAATGGG + Intergenic
1112046585 13:95603856-95603878 TGGGAGGATCTAGGTAAAATGGG - Intronic
1112707219 13:102084181-102084203 TGGGAAGTTCCATTTTAAATAGG - Intronic
1115096345 14:29640814-29640836 TGGGAAATCCTATGAAAAGCTGG + Intronic
1115567983 14:34641248-34641270 TAGGAACTTCCATTAAAAATAGG - Intergenic
1116545049 14:46154801-46154823 TGGGAATTTGTATAACAAATGGG + Intergenic
1117234341 14:53755379-53755401 TGGGAAATTCAATGAGAAAGAGG + Intergenic
1117255751 14:53975765-53975787 TGGGAAGCTTTATGAAAAAGAGG - Intergenic
1118473514 14:66095997-66096019 TGGGAAGTTTGATGAAGAAAAGG + Intergenic
1123137892 14:106046794-106046816 TGGGAAGGTCTATGGTAGATGGG - Intergenic
1123203958 14:106694111-106694133 TGGGAAGGTCTATGGTAGATGGG - Intergenic
1123208988 14:106740616-106740638 TGGGAAGGTCTATGCTAGATGGG - Intergenic
1123547454 15:21351595-21351617 GGGGAATTTCTATGAAGAAGAGG + Intergenic
1123714654 15:23018455-23018477 TGAGAATTTTTGTGAAAAATAGG - Intronic
1125088153 15:35756291-35756313 TGGGAAATTCTTGGAAATATTGG + Intergenic
1125257873 15:37787728-37787750 AGAGAAGTTCTCTGAAAAAGGGG - Intergenic
1125867670 15:43068566-43068588 TTGAAAGTAATATGAAAAATTGG - Intronic
1125951210 15:43753422-43753444 TGGGGAATTCTATCAGAAATGGG + Intronic
1126225737 15:46267042-46267064 AGGGGAGTTATATGTAAAATAGG - Intergenic
1126364923 15:47884275-47884297 TGGGAAGTGATTGGAAAAATAGG - Intergenic
1127597946 15:60505663-60505685 AGCGAAGTTCTTTGAATAATTGG + Intronic
1128037868 15:64542389-64542411 AAGGAAGTTCTAGAAAAAATTGG - Intronic
1129615456 15:77095832-77095854 TAGGAACTTTTATAAAAAATTGG - Intergenic
1130236955 15:82144477-82144499 AGGGAAGCTTTATGAGAAATTGG - Intronic
1130731881 15:86502967-86502989 TGGAAAGTTTTGTGAAAGATTGG + Intronic
1131852612 15:96559007-96559029 TGGGAAATTTTCTGAAAAGTTGG - Intergenic
1202955784 15_KI270727v1_random:78825-78847 GGGGAATTTCTATGAAGAAGAGG + Intergenic
1133645150 16:7757055-7757077 TGGTAAGTGCTATGAAAAACTGG + Intergenic
1135092172 16:19525860-19525882 TGGTAAGTGCTATGAAAATTGGG + Intronic
1137484203 16:48878104-48878126 TGGAAAGTTCCAGGAAAACTGGG + Intergenic
1139390250 16:66602855-66602877 CGGGAAGTACTAAGGAAAATTGG - Intergenic
1142013513 16:87730259-87730281 TGGCTAGTTCTATCTAAAATGGG - Intronic
1142484400 17:237290-237312 TGGGGAGTTTTAAGAAAAATGGG - Intronic
1143793592 17:9317967-9317989 TGGGAAGCTCTATGTAAATGTGG - Intronic
1145771852 17:27498967-27498989 TGAGGACTTCTATGAAAAAATGG + Intronic
1146695273 17:34904068-34904090 TGGGTAGTTTTCTGAAAAAAAGG + Intergenic
1149106505 17:52973646-52973668 TTAAAAGTTCTGTGAAAAATTGG - Intergenic
1150716841 17:67579370-67579392 TGGGAAGTTCCATGAACTCTGGG - Intronic
1151018528 17:70585030-70585052 AGGGAAGGTATATGTAAAATAGG + Intergenic
1153719447 18:7886883-7886905 TGGGAATTACTATAAAAAAGTGG + Intronic
1154267379 18:12890923-12890945 TGTGACCTTCTATGAAAAAAGGG + Intronic
1154448555 18:14457197-14457219 GGGGAATTTCTATGAACAAGAGG + Intergenic
1155121686 18:22827119-22827141 GAGGAAGTTCTGTGAAAAAGGGG - Intronic
1155595288 18:27478967-27478989 TGAGAAATGGTATGAAAAATAGG - Intergenic
1155828706 18:30483216-30483238 TTGGAACTTCTATTAAAAGTTGG + Intergenic
1155861333 18:30904261-30904283 TGGAAAGTTTTTAGAAAAATAGG + Intergenic
1155896415 18:31333506-31333528 TGTAAAGTTCTTTGAAAAGTTGG - Intronic
1156528760 18:37795000-37795022 TGGGATGATGAATGAAAAATGGG + Intergenic
1156833696 18:41527069-41527091 TGGGAAGTTCTTGGAAGAATGGG - Intergenic
1156835357 18:41546903-41546925 TCAAAATTTCTATGAAAAATCGG + Intergenic
1159294157 18:66460298-66460320 TGGGAAGTGGTATGAGGAATGGG + Intergenic
1162750383 19:12825925-12825947 TGCGAAGGTCTAGGAAAAAGTGG + Exonic
1164126705 19:22325002-22325024 TGGGCAGTTAGCTGAAAAATGGG - Intergenic
1166483561 19:43194176-43194198 TTGGAAGTTCTTAGACAAATTGG + Intronic
1166497130 19:43311717-43311739 TGGGGAGTTAAATGAAAAATGGG + Intergenic
1167230909 19:48282562-48282584 TGGGAAGTGCATTGGAAAATGGG + Intronic
927005579 2:18844572-18844594 TGGCAAGTTTTGTGATAAATAGG - Intergenic
928418558 2:31118928-31118950 TGGGAAATTATATGACAAAGTGG + Intronic
929298162 2:40271509-40271531 TGGTAAGGACTGTGAAAAATAGG - Intronic
929406422 2:41648025-41648047 TGGAAAGTGCTTTGATAAATAGG + Intergenic
929734427 2:44531597-44531619 TGGAAAGCCCTATGAAAAAAGGG - Intronic
929773490 2:44912977-44912999 TGGGAAGGTTTATGAAATACAGG + Intergenic
930880118 2:56260905-56260927 AGGCAAGTTCTATAAGAAATAGG - Intronic
931102285 2:59015603-59015625 AGGGTAGGTATATGAAAAATAGG + Intergenic
931786161 2:65621239-65621261 TGGGAAGCGATAAGAAAAATGGG + Intergenic
933773290 2:85756946-85756968 TGGGAAGTTCTCTATAAAAAGGG + Intronic
935088223 2:99869103-99869125 TAGGAACTTATATTAAAAATAGG - Intronic
935635537 2:105247108-105247130 TGGAAAGTTCTTTGAGAAAATGG + Intergenic
937015996 2:118606271-118606293 TGCGTAGTCCTATGAAAAACCGG - Intergenic
940232417 2:151470878-151470900 TGGGAAAGTCTATGAGAATTAGG + Intronic
940673845 2:156704783-156704805 TGTGAAGTTTTATTAAAGATGGG - Intergenic
940750958 2:157627274-157627296 TGGGAAAGTCTTTAAAAAATGGG - Intronic
941920290 2:170843652-170843674 TTCCAAGTTCTATGTAAAATTGG - Intronic
942527961 2:176875754-176875776 TGAGATGTTCTATTAGAAATTGG - Intergenic
942543601 2:177039757-177039779 GGGGAACTTCTAAGGAAAATGGG + Intergenic
943348070 2:186764122-186764144 AGGGAAATTTTAAGAAAAATGGG - Exonic
943456781 2:188118304-188118326 TGGGAAGTCCTGTGAAAAACTGG - Intergenic
944481959 2:200166371-200166393 TGGAACATTCTATTAAAAATAGG + Intergenic
946509939 2:220345013-220345035 TTGGAAGTTCTAAGATAACTGGG + Intergenic
946992539 2:225351524-225351546 TGGGAAGTTCTTTGGAAGATGGG + Intergenic
948419902 2:237851219-237851241 AGTGAAGATCTATGAAAACTTGG - Intergenic
1172509790 20:35492582-35492604 TGGGAAGTTCAAGGACAAAAAGG + Intronic
1176447678 21:6833322-6833344 GGGGAATTTCTATGAACAAGAGG - Intergenic
1176825847 21:13698348-13698370 GGGGAATTTCTATGAACAAGAGG - Intergenic
1184965020 22:47965418-47965440 TAGGAAGTTCCATGTAAAGTTGG - Intergenic
949950794 3:9227122-9227144 TGGGAAGATCTAGGAACACTGGG - Intronic
951706448 3:25548781-25548803 TGGGAATGTATATAAAAAATGGG - Intronic
953121625 3:40048858-40048880 TTGGAAGTTCTATAGAAAATGGG + Intronic
957535544 3:81498070-81498092 TGGAAAGTCCTATGAGAATTAGG - Intronic
957714662 3:83910464-83910486 TAGAAAGTTTTATGAAAATTAGG - Intergenic
957714904 3:83914839-83914861 TAGAAAGTTTTATGAAAATTAGG - Intergenic
958521639 3:95197086-95197108 GGGAAAGTTTTATGAACAATAGG - Intergenic
959293578 3:104505760-104505782 TGGAAAGGTTTAAGAAAAATTGG - Intergenic
959897778 3:111624622-111624644 TGATAAGTTATATGAAAAAAAGG + Intronic
959900511 3:111656171-111656193 TGAAAAATCCTATGAAAAATGGG + Intronic
962503323 3:136018407-136018429 TGGGATGTTTTAAGAAAAAATGG - Intronic
963043949 3:141088899-141088921 TGTGGAGCTCTATGAGAAATTGG - Intronic
963507394 3:146204132-146204154 GGGGTAGTTCTTTGACAAATTGG + Intronic
963578785 3:147098118-147098140 TAAGAATTTCTATGGAAAATTGG - Intergenic
965355609 3:167669430-167669452 TGGGATGTCCAATCAAAAATTGG + Intergenic
967465427 3:189800069-189800091 TGGAAAGTGCTATGAAAATGTGG + Intronic
967675640 3:192295801-192295823 TTGGAATAGCTATGAAAAATGGG - Intronic
968942400 4:3645618-3645640 TTGGAAGTTCTATTAAAAAGAGG - Intergenic
970338719 4:15082163-15082185 AGGGAAGAGCTATGAAAAACAGG - Intergenic
971010389 4:22428044-22428066 TTGGAAGTTTTATCAAAATTAGG + Intronic
971812792 4:31448889-31448911 TAGGAATTGCGATGAAAAATAGG - Intergenic
972071982 4:35032379-35032401 TGGGTAGCTCTCTGAAAAGTTGG - Intergenic
972207547 4:36795242-36795264 TGTTAAATTCTATGAAATATTGG - Intergenic
972330448 4:38059372-38059394 AGGGAAATTGTATGATAAATAGG + Intronic
973099289 4:46242926-46242948 TGAGAAGTTTTTTAAAAAATGGG - Intergenic
973587366 4:52406663-52406685 TGGAAAGATCTTTGAAAGATGGG + Intergenic
974241910 4:59260207-59260229 AAGGAAGTTCTATGAACATTTGG + Intergenic
974294301 4:59975990-59976012 TGGAAAGTGCAATGGAAAATGGG - Intergenic
974313192 4:60240210-60240232 TTGGAAGTGCTACTAAAAATAGG + Intergenic
975081813 4:70289890-70289912 TGTGAAGTTCTTGGAAAAAACGG + Intergenic
975743054 4:77449293-77449315 TGGGAAGTACTCTGATAAATGGG + Intergenic
976741193 4:88359366-88359388 TGGGAACTACAATGAAAGATTGG - Intergenic
976896948 4:90124479-90124501 TGGCAAGTTCAATGAAGATTTGG - Intergenic
977097490 4:92764615-92764637 TGTTAAGTTCTATAAAAAAGGGG - Intronic
982643063 4:157986675-157986697 AAGGAAGTTCTAGGAAAGATAGG - Intergenic
983323042 4:166218419-166218441 TGGAAAACTATATGAAAAATTGG - Intergenic
984312337 4:178078064-178078086 TGGGATTTTCTATGATGAATTGG - Intergenic
984536592 4:180983356-180983378 TGGTAAGTACTATGAAAAGGTGG - Intergenic
984625155 4:181998717-181998739 TGGGAAGTTCTAACAGGAATGGG - Intergenic
986932285 5:12840794-12840816 TGTGAATTTCTATGAGAAAATGG - Intergenic
987621350 5:20341019-20341041 TGGGAAACTCAAGGAAAAATTGG + Intronic
988014373 5:25534520-25534542 TGGTAAGTTCTTTGAATAAGTGG - Intergenic
988323259 5:29728065-29728087 TGAGAAGTTTTAAGAAAAGTGGG + Intergenic
988444662 5:31272014-31272036 TGGCAAGTTCAGTGATAAATTGG + Intronic
989991174 5:50768251-50768273 TGAGTAGTTCCATTAAAAATAGG + Intronic
990806944 5:59674307-59674329 TGGAAAGTTCTATGAAGACAAGG + Intronic
991608915 5:68430541-68430563 TGGGAAGGTCCATGAATATTTGG + Intergenic
991633019 5:68675571-68675593 TTGGAAGCTCTTTGGAAAATAGG - Intergenic
991963498 5:72068418-72068440 TAGGAAGTTCTAAGAATAGTGGG - Intergenic
992273185 5:75087163-75087185 TCTGAAGATATATGAAAAATGGG - Intronic
992382704 5:76254510-76254532 TGGAAATTTCCATGGAAAATAGG - Intronic
992472711 5:77074353-77074375 TGGGAAGATGCATGATAAATGGG + Exonic
992787232 5:80182119-80182141 TGAGAAGTACTAAGAAGAATTGG + Intronic
993511023 5:88771559-88771581 TAGTGAGTTCTGTGAAAAATGGG + Intronic
996466044 5:123803722-123803744 TGGGGAGTTCTGTGAAATATGGG + Intergenic
996746030 5:126846656-126846678 GGGGAAATTCCATGAAAAAAAGG + Intergenic
997313155 5:132907312-132907334 TGGGAAGTTCTATGAAAAATAGG - Intronic
997825986 5:137107179-137107201 TTGTAAGTTCCATGAAAACTGGG + Intronic
998928916 5:147158602-147158624 GGTCATGTTCTATGAAAAATGGG - Intergenic
999822181 5:155239297-155239319 TGGGAAGCCCTAGGAAATATGGG - Intergenic
999884357 5:155904276-155904298 TGGTAAGTTCTATCAAGAATGGG - Intronic
1000204357 5:159044012-159044034 TGAGAAGTTCTTTGAGAGATGGG + Intronic
1001130629 5:169060729-169060751 AGAGAAGTTCTATGAACAACAGG + Intronic
1003221040 6:4161190-4161212 TGGCAAGTTGTGAGAAAAATGGG - Intergenic
1005027049 6:21473276-21473298 TGTGAAGTTCTATGAAAGATTGG - Intergenic
1005276072 6:24219755-24219777 AGTGAAGTTCAATGAAAAACTGG + Intronic
1005916777 6:30359279-30359301 TGGGAAGTTCTAAAAGCAATAGG - Intergenic
1006540597 6:34736866-34736888 AGGGTAGTTATATGTAAAATAGG - Intergenic
1007266368 6:40599387-40599409 TGGGAACCTCTAGGAGAAATTGG + Intergenic
1007731146 6:43947772-43947794 TAGGAAGTCCTATCAAGAATTGG - Intergenic
1010127939 6:72455867-72455889 TGCAAAGTTCTATTAAAAATTGG + Intergenic
1010558681 6:77319281-77319303 TGGAAAGCTCTATGAGAAAATGG + Intergenic
1011100397 6:83714014-83714036 TGGAATGTTCTAAGAAACATAGG - Intergenic
1011637556 6:89388344-89388366 TGGGGAGTTCTATGTTTAATGGG + Intronic
1012534812 6:100282648-100282670 TGTTAAGTGCTATGAAAGATAGG + Intergenic
1013474017 6:110490738-110490760 TTGGAAGGTTTCTGAAAAATTGG + Intergenic
1013670751 6:112399809-112399831 TGGGTAGGTATATGTAAAATAGG + Intergenic
1014056497 6:117022128-117022150 TGGGAAGTGTTCTGAAAACTAGG - Intergenic
1016162749 6:140901697-140901719 AGGGTAGTTATATGTAAAATAGG + Intergenic
1017768778 6:157628695-157628717 TGGAAAGTGCTGTGAAAGATGGG - Intronic
1018300646 6:162399000-162399022 CAGGAAGTATTATGAAAAATGGG + Intronic
1018566045 6:165154637-165154659 TGTGTATTTCTATTAAAAATGGG + Intergenic
1021680188 7:23122246-23122268 ATGGAACTTCTATGAAACATAGG - Intronic
1024849669 7:53696627-53696649 TGTGAATTTCTATGAAATGTAGG - Intergenic
1027297581 7:76793484-76793506 AGGTAAGTTCTATGAAACAAAGG - Intergenic
1027839251 7:83286979-83287001 TGGGAAATTCTAAGATCAATTGG + Intergenic
1028433641 7:90776810-90776832 TTTGAGGATCTATGAAAAATTGG + Intronic
1028693843 7:93685064-93685086 TGGGAGTTTCTGTGAAAAAGTGG - Intronic
1028709236 7:93889215-93889237 TGGGAACTTCTAGGAAAAGGAGG + Exonic
1029810990 7:103048537-103048559 TGTGAGGTTTTATTAAAAATTGG - Intronic
1030384251 7:108848503-108848525 AGGGTAGGTATATGAAAAATTGG + Intergenic
1030594247 7:111517999-111518021 TGGTAAATTCAATGGAAAATAGG - Intronic
1031247093 7:119327771-119327793 TGGGAATTTCTGTGTAAGATTGG + Intergenic
1031667606 7:124503994-124504016 TGGGTAGGTATATGTAAAATTGG + Intergenic
1032925044 7:136594578-136594600 TGGGGTGTACTTTGAAAAATTGG - Intergenic
1033370632 7:140704267-140704289 AGAGAAGTTCTAAGAGAAATGGG - Intronic
1033733133 7:144197403-144197425 TGGGAAACTATAGGAAAAATTGG + Intergenic
1033743986 7:144295969-144295991 TGGGAAACTATAGGAAAAATTGG + Intergenic
1033749915 7:144353585-144353607 TGGGAAACTATAGGAAAAATTGG - Intergenic
1033798450 7:144874433-144874455 TGGAAATTAATATGAAAAATTGG + Intergenic
1034102632 7:148464004-148464026 TGGAGAGTTCTAGGAAAGATCGG - Intergenic
1034748758 7:153548550-153548572 TTGGTAATTCTATGATAAATTGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036385918 8:8281534-8281556 TTAGAAGTGCTATGAAAGATTGG - Intergenic
1037160485 8:15765502-15765524 TGTGAATTTCAATGAAGAATGGG + Intronic
1037676306 8:21053789-21053811 TGGGAAAGTCTAGGAAAACTGGG - Intergenic
1041609158 8:59823673-59823695 TGGAAAAGTTTATGAAAAATTGG + Intergenic
1043381269 8:79704750-79704772 TGTGAAGATCTGTGAAGAATTGG - Intergenic
1043992410 8:86772137-86772159 TGGAAAGTGCAAAGAAAAATAGG + Intergenic
1045074683 8:98551007-98551029 TTGGAGGTTATATGAACAATGGG - Intronic
1047136663 8:122086899-122086921 TGGGAAGGTCATTGAGAAATTGG + Intergenic
1051547015 9:18288120-18288142 TGGGAAATTCTAGGTGAAATAGG + Intergenic
1052242513 9:26291621-26291643 GGGGTAGTTTTATGAAAATTTGG - Intergenic
1053086966 9:35233328-35233350 GGGGAAGTGCTATGGGAAATTGG - Intronic
1055142232 9:72888750-72888772 TGGGAAGTTCATTGAAATGTAGG + Intergenic
1055673623 9:78632467-78632489 TGTGAAGATGTGTGAAAAATTGG + Intergenic
1056794217 9:89646472-89646494 TAGGAGGCTCTTTGAAAAATAGG + Intergenic
1057561097 9:96128463-96128485 TGGGAAGCTCCATGAAAGCTAGG + Intergenic
1057897847 9:98924116-98924138 TGGGAAGATCTTTAAGAAATAGG - Intergenic
1057944120 9:99309702-99309724 TGTGAAGATCTGTGAAACATGGG - Intergenic
1057949078 9:99355652-99355674 TGTGATGTTCTATGAAAGAGAGG + Intergenic
1060557042 9:124513406-124513428 TGGGAATGTCTATGAGAACTCGG + Intergenic
1061044131 9:128155283-128155305 TGGGGAGGTATATGTAAAATAGG - Intergenic
1061633550 9:131890154-131890176 TGTGAAGTGCTCTGAAAAAAAGG + Intronic
1203521513 Un_GL000213v1:51209-51231 GGGGAATTTCTATGAACAAGAGG + Intergenic
1186903665 X:14087243-14087265 TTGCAATTTCTATAAAAAATGGG + Intergenic
1192911789 X:75612447-75612469 TGTGAAGTTCTAGGACACATGGG + Intergenic
1194086651 X:89536499-89536521 TGGGAATTTTGATGAGAAATAGG - Intergenic
1195936394 X:110129819-110129841 TGCTAAGTTCTATGAAATATCGG + Intronic
1196886138 X:120247545-120247567 TGGAAAGTTTTAAGAAAAAAGGG + Intergenic
1199531883 X:148857534-148857556 TGCTAAATTATATGAAAAATTGG - Intronic
1199676350 X:150193050-150193072 TATGATGTTCTATGAAAAATCGG + Intergenic
1200419280 Y:2946366-2946388 TGGGAACTCATATGAAATATTGG - Intronic
1200439310 Y:3192373-3192395 TGGGAATTTTGATGAGAAATAGG - Intergenic
1201620623 Y:15953097-15953119 TGGGAACTTATATGGAAAAGGGG + Intergenic
1201860652 Y:18593951-18593973 TTGAAATTTTTATGAAAAATTGG + Intergenic
1201872671 Y:18726429-18726451 TTGAAATTTTTATGAAAAATTGG - Intergenic