ID: 997316781

View in Genome Browser
Species Human (GRCh38)
Location 5:132943141-132943163
Sequence GCAGCTGGTGAATTTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997316781 Original CRISPR GCAGCTGGTGAATTTGAAGC TGG Intronic
900925762 1:5705282-5705304 GCAGCTGGAGATTGTCAAGCTGG + Intergenic
901168002 1:7233680-7233702 GCAACTGGAGGTTTTGAAGCAGG - Intronic
904457216 1:30655058-30655080 GGAGCTGCAGAATTTGAACCTGG - Intergenic
904573789 1:31488573-31488595 GGTGTTGGTGAATTTGAAGCTGG - Intergenic
904931511 1:34090894-34090916 AAAGCTGGTGGATATGAAGCTGG - Intronic
905313871 1:37068803-37068825 ACAGCTGGAGGATTTGAGGCTGG - Intergenic
906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG + Exonic
907649832 1:56284660-56284682 ACAGGTGGAGAATTTCAAGCAGG + Intergenic
907714787 1:56916636-56916658 GGAGCTGCTCTATTTGAAGCTGG - Intronic
909148574 1:71970344-71970366 GCATCAGGGGAATTTTAAGCAGG + Intronic
909579360 1:77216659-77216681 GCAGCTGTTGAGTTTGGAGGGGG - Intronic
909774006 1:79461849-79461871 TCAGTTGATGAATTTGAAGCTGG - Intergenic
911323960 1:96447284-96447306 GGTGTTGGTGAATTTGAAGCTGG + Intergenic
912671414 1:111630871-111630893 GCAACTTGTGAATTTGAAGATGG + Intronic
915619826 1:157074377-157074399 GCAGCTGATGAACGTCAAGCTGG + Intergenic
916527699 1:165627182-165627204 GCTGCCAGTGAATATGAAGCAGG + Intergenic
917967928 1:180190205-180190227 ACAGCTGGGGAAGTTGAGGCTGG + Intronic
919581950 1:199387451-199387473 ACAGTAGATGAATTTGAAGCTGG + Intergenic
921163015 1:212486322-212486344 GCATCTGGTCTATTTGCAGCAGG + Intergenic
921164663 1:212498163-212498185 GCAGATGGGGATTCTGAAGCGGG - Intergenic
921342330 1:214146549-214146571 GCATCTGGTTCATTTGAACCTGG - Intergenic
921839146 1:219809877-219809899 GCAGCTGGGGAATAATAAGCTGG - Intronic
922371930 1:224919939-224919961 TTATCTGGTGAATTTGAGGCAGG - Intronic
923310683 1:232731934-232731956 GCAGTTGGTTTATTTGAATCAGG + Intergenic
923338212 1:232987638-232987660 GCATCTGGTGATTGTGAAGCGGG + Intronic
924077513 1:240355812-240355834 TCAGCCTGTGAAGTTGAAGCAGG + Exonic
924842105 1:247723244-247723266 ACAGATGGTGAATTTGAAGGTGG + Exonic
1064256993 10:13750783-13750805 GCACCTGGTGATTTTCAAACGGG + Intronic
1064998684 10:21318022-21318044 GCAGCTGGTGGATTTGGGCCAGG - Intergenic
1065565636 10:27005702-27005724 GCTGCTGCTGAATTGGAATCTGG - Exonic
1066469161 10:35681332-35681354 GTTGCTGGTGAACTTGAAACAGG - Intergenic
1069822528 10:71236485-71236507 CCAGCTCGTAAATATGAAGCCGG + Intronic
1071770981 10:88728591-88728613 GGAGCTGATGAATGTCAAGCTGG + Intronic
1071937260 10:90545784-90545806 GCTGCCAGTGAATATGAAGCAGG + Intergenic
1076191097 10:128483954-128483976 GCAGCTGAAGAAATTGAGGCTGG - Intergenic
1076221151 10:128734116-128734138 GCCTGTGGTGCATTTGAAGCAGG - Intergenic
1077227199 11:1443524-1443546 GCTGCTGGAGAAGGTGAAGCGGG + Exonic
1077564643 11:3289813-3289835 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1077564671 11:3289997-3290019 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1077570532 11:3335630-3335652 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1077570561 11:3335814-3335836 GCCGCTGGTGACATTGAAGAGGG + Intergenic
1078370205 11:10737971-10737993 GCAGTTAATGAATTTGAAGTAGG - Intergenic
1078865222 11:15290965-15290987 ATAGATAGTGAATTTGAAGCTGG + Intergenic
1079125593 11:17716588-17716610 GCTGCTGGGGAGTTTGAAGCAGG + Intergenic
1080049985 11:27849569-27849591 GCAGCTGGTGAATAGACAGCAGG - Intergenic
1082811053 11:57479209-57479231 GCTGCTGGTAAATTAGAGGCAGG + Intergenic
1083797561 11:65026208-65026230 GGTGTTGATGAATTTGAAGCTGG - Intronic
1084313757 11:68331895-68331917 GAAGCTGGTGAGTGTGAGGCGGG + Intronic
1084583278 11:70037846-70037868 GCAGCTGGGGAAACTGAGGCAGG + Intergenic
1084805366 11:71575216-71575238 GCTGCTGGTGAAATTGAATATGG - Intergenic
1084860519 11:72014982-72015004 ACAGCTGATGACTTTGAAGGAGG - Exonic
1085928273 11:81049334-81049356 TCAGCTTGTGAATTTGAAGAAGG + Intergenic
1086756735 11:90573235-90573257 GCAGATGGTGAAATGGGAGCAGG + Intergenic
1089365217 11:117917289-117917311 GCAGCAGGGGAATATGAGGCTGG + Intronic
1089599208 11:119603159-119603181 GGAGCTGATGAACGTGAAGCTGG - Intergenic
1089629214 11:119773573-119773595 GCAGCAGGAGAAATGGAAGCTGG - Intergenic
1089676994 11:120096868-120096890 GCGGCTGGGGAATTTGAAGCGGG - Intergenic
1090731253 11:129574897-129574919 TCAGCTGCTGTATTTGAAGCTGG - Intergenic
1091317801 11:134627039-134627061 GCAGCTTGTAAATTTAAAGCTGG + Intergenic
1091594694 12:1869368-1869390 GCAGCGGGTGGCTTTGAATCTGG - Intronic
1092191858 12:6526964-6526986 GCAGCTGGTCCACTTGGAGCAGG + Exonic
1093264876 12:16991024-16991046 GGTGTTGGTGAATTTGAAGCTGG + Intergenic
1093466756 12:19457258-19457280 AGTGTTGGTGAATTTGAAGCTGG - Intronic
1093668906 12:21848968-21848990 GGAGCTGGTGTGTTGGAAGCAGG - Intronic
1094019894 12:25902975-25902997 AAAGCTGGTGAACTTAAAGCTGG - Intergenic
1095568933 12:43660069-43660091 GGTGTTGGTGAATTTGAAGCTGG + Intergenic
1095864809 12:46959748-46959770 GCAGCTTGTGAAATTCAAGCAGG + Intergenic
1096564831 12:52469725-52469747 GGAGCTGATGAATGTCAAGCTGG - Exonic
1096566751 12:52488383-52488405 GGAGCTGATGAATGTCAAGCTGG - Exonic
1096589297 12:52646795-52646817 GGAGCTGATGAACGTGAAGCTGG - Exonic
1096609441 12:52791261-52791283 GGAGCTGATGAATGTCAAGCTGG - Exonic
1096614308 12:52823071-52823093 GGAGCTGATGAATGTCAAGCTGG - Exonic
1097490654 12:60265983-60266005 GCAACTGGTGATTTTGAAGATGG - Intergenic
1097615585 12:61880447-61880469 GGAGCTGATGAATGTCAAGCTGG + Intronic
1098055653 12:66502687-66502709 GCAGAAGGTGAAGTGGAAGCAGG - Intronic
1098264720 12:68706747-68706769 GGAGCTGATGAACTTCAAGCTGG + Intronic
1098433360 12:70444349-70444371 GCAGAAGGTGAAGTAGAAGCAGG - Intergenic
1100785187 12:98071197-98071219 GCAGAAGGTGAAGTGGAAGCAGG + Intergenic
1101034542 12:100692422-100692444 GCAGAAGGTGAAGTGGAAGCAGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102130787 12:110527196-110527218 GCCGTTGCTGATTTTGAAGCTGG - Intronic
1107158981 13:37203521-37203543 GCAGGTGGTGAATTCTAAGAAGG + Intergenic
1107882873 13:44848512-44848534 CCAGCTGCTCAATCTGAAGCAGG - Intergenic
1109002889 13:56829215-56829237 GCAGCTGATCAATTTGGAGGAGG + Intergenic
1110852864 13:80264305-80264327 GCAGAAGGTGAATGGGAAGCAGG + Intergenic
1113640253 13:111952247-111952269 GCAGCTGGTCAGTGTGATGCAGG + Intergenic
1114530105 14:23390131-23390153 GCAGCGGGTGAAGCAGAAGCTGG - Exonic
1114535535 14:23419919-23419941 GCAGCGGGTGAAGCAGAAGCTGG - Exonic
1114752702 14:25223395-25223417 GCAGAAGGTGAATGGGAAGCAGG + Intergenic
1115142105 14:30183829-30183851 GAAGCTGGTCAGTTTGAAGTAGG + Intronic
1116216684 14:42025471-42025493 GCAGCTGGGGAATATAATGCTGG + Intergenic
1116694249 14:48151288-48151310 GCAGCAGGTGAAATGGAAGCAGG - Intergenic
1118132038 14:62977253-62977275 GCTGCTGGGGAAGTTGAGGCAGG + Intronic
1120279732 14:82423374-82423396 TCAGCTGATGAATCTGAAGTAGG - Intergenic
1121644899 14:95511109-95511131 GCAGCAGGTGAAGATGGAGCAGG - Intergenic
1123707453 15:22960266-22960288 GAAGCTGGTGAGGTTGATGCTGG - Intronic
1125490710 15:40146702-40146724 GCTGCCGGTGAATATAAAGCAGG - Intergenic
1126575753 15:50194592-50194614 GAAGCTGATAAATTAGAAGCAGG + Intronic
1127359010 15:58228674-58228696 GAGGCTGGTGAAGTTGCAGCGGG + Intronic
1127750198 15:62030409-62030431 GCAGAAGATGAATTGGAAGCAGG - Intronic
1128842258 15:70859837-70859859 GGAGCTGATGAATGTCAAGCTGG + Intronic
1130916207 15:88307093-88307115 GGAGCTGGTGGCTTAGAAGCAGG - Intergenic
1132080044 15:98855914-98855936 GCAGCTGGTCAGTTTGCAGAAGG + Intronic
1135979314 16:27134803-27134825 GGTGTTGGTGAATTTGAAGCTGG - Intergenic
1136118645 16:28113271-28113293 GCTGCTGGTGACTGTGAAGGAGG - Intronic
1136283603 16:29228792-29228814 CCAGCGGGTGACTTTGGAGCAGG + Intergenic
1138236780 16:55390246-55390268 GAAGCTGGGAAAGTTGAAGCTGG - Intronic
1138891855 16:61153192-61153214 TGAGCTGGAGAATTTGAAACCGG - Intergenic
1139393012 16:66617770-66617792 CCAGCAGGTGACTCTGAAGCTGG - Intronic
1141222886 16:82088198-82088220 GCTGCTGGAGATTCTGAAGCAGG + Intronic
1141461994 16:84183255-84183277 GATGCTGGAGAATTTCAAGCTGG - Exonic
1141705276 16:85661365-85661387 GCCGCTGGTGAAGGTGGAGCGGG + Exonic
1143694249 17:8599570-8599592 GGAGCTTGTGAAAATGAAGCAGG - Intronic
1143732012 17:8886719-8886741 GGAGCTGGTGAGGTGGAAGCAGG + Intronic
1143919393 17:10318864-10318886 GCAGCGGGTGAAGCAGAAGCTGG - Exonic
1147178165 17:38669611-38669633 GCAACTGTTGAATTTGAGGTTGG + Intergenic
1147551509 17:41445929-41445951 GCACTTGGGGAAGTTGAAGCGGG - Intergenic
1147866228 17:43554429-43554451 GGAGCTGGGGAGTCTGAAGCGGG - Intronic
1148227833 17:45911381-45911403 GCTGCTGGGGAATCTGAGGCAGG + Intronic
1148892442 17:50817767-50817789 GCAGATCGTGAACTTGAAGGAGG - Intergenic
1149453669 17:56770128-56770150 GCAGCTGGAAAATTTTAATCAGG - Intergenic
1150706417 17:67491230-67491252 GCAGCTGGTGCACTTGACTCTGG + Intronic
1151412455 17:73940415-73940437 GCAGGTGGGGAAATTGAGGCAGG + Intergenic
1151815993 17:76471672-76471694 GCGGCTGGTGAAGGGGAAGCAGG + Exonic
1203168627 17_GL000205v2_random:124250-124272 GCTGCTGGGGAATCTGAGGCAGG + Intergenic
1154412648 18:14149687-14149709 GCAGTTGGTGACTCTGGAGCTGG - Intergenic
1158410568 18:57201713-57201735 GCAACTCGGGAAGTTGAAGCAGG + Intergenic
1161398274 19:4056220-4056242 ACAGCTGGGGAAATTGAGGCTGG - Intronic
1163382228 19:16976645-16976667 GCAGCTGGTCATTGTGCAGCGGG + Intronic
1164409526 19:27989192-27989214 GCAGCTGGTGAAAGAGAAGGTGG - Intergenic
1165368185 19:35383028-35383050 GGTGTTGGTGAATTTGAAGCTGG + Intergenic
1166830101 19:45634174-45634196 GCAGCTGGTGGCTTTGGAGAGGG + Intronic
1167196940 19:48035880-48035902 GCCACTGGAGAATTTTAAGCAGG + Intronic
1167729162 19:51240858-51240880 GCTGCTGATGAATTTGGGGCTGG - Intronic
925039799 2:723020-723042 GCAGATTGTGTATTTGAAGAGGG - Intergenic
925104341 2:1277739-1277761 GCAGCTGGTGACATGCAAGCTGG + Intronic
925518188 2:4708455-4708477 GCAGCTGGTGAAAGTCAAGCTGG + Intergenic
925550746 2:5071473-5071495 GTAGCTGGTGACAATGAAGCTGG - Intergenic
925808207 2:7673275-7673297 CCTGCTGGAGAATTTTAAGCAGG + Intergenic
926951808 2:18251572-18251594 GCAGATGGTGAAGGGGAAGCAGG + Intronic
929503744 2:42511903-42511925 GCTGCTGGGGAGTCTGAAGCAGG + Intronic
930508636 2:52316871-52316893 GCAGCTGGTGAATAGGAGGGAGG - Intergenic
930603253 2:53466325-53466347 GCAGCTGTGGAATTTTAAGTCGG + Intergenic
932360684 2:71103186-71103208 GCAGAAGGTGAAGTTGGAGCAGG - Intergenic
934077467 2:88440347-88440369 GCAGGTGGACCATTTGAAGCTGG + Intergenic
934706242 2:96483674-96483696 GCAGCTGGTGGGTTGGGAGCAGG + Intergenic
935801221 2:106698300-106698322 GGTGTTGGTGAATTTGAAGCTGG - Intergenic
937291636 2:120785491-120785513 GCAGCTGGGCAAGTTGGAGCAGG + Intronic
937647793 2:124285047-124285069 ACAGTTTGTGAATTTGAAACAGG + Intronic
938626783 2:133118691-133118713 GGAGATGGTGAATTTGGAGCTGG + Intronic
939263980 2:139848348-139848370 GAAGCAGGTGCATTTGAAGTGGG + Intergenic
940887691 2:159003822-159003844 GCTGTTGGTAAATCTGAAGCAGG - Intronic
942772116 2:179534024-179534046 GCTGCCGCTGAATTTGGAGCAGG - Intronic
943991606 2:194700820-194700842 GCAGCTGTTGTAATTTAAGCAGG + Intergenic
944231867 2:197403718-197403740 AAAGCTCGTGAATTTGGAGCTGG - Exonic
944772201 2:202925765-202925787 GGAGCTGGTGAATGTTAAACTGG + Intronic
945222364 2:207497834-207497856 GCTACTGATGAATTTGAAGATGG - Intergenic
947286479 2:228521908-228521930 AGAGCTGGTGAACTTGAAGATGG + Intergenic
948038517 2:234879687-234879709 GTAGCTGGTGTATTTGAGGATGG + Intergenic
948100783 2:235371054-235371076 GCAGCTGGTAACTTTTGAGCTGG - Intergenic
948851874 2:240712272-240712294 GCAGCTGGGGAGTGTGAACCAGG + Intergenic
948942200 2:241202241-241202263 GCAGCTGGTGGATCCCAAGCAGG - Exonic
1169210813 20:3765380-3765402 GCAGATCCTGAATTTGAACCAGG - Intronic
1170047831 20:12105433-12105455 GCCCCTGGTGAATATAAAGCAGG + Intergenic
1170773155 20:19351736-19351758 CCAGGTGGTTAGTTTGAAGCAGG + Intronic
1173164199 20:40674821-40674843 GAAGTTGGTGAATTTGTAACAGG - Intergenic
1174543274 20:51306438-51306460 ACAGCTGCTGCATTTGAAGCAGG + Intergenic
1174548927 20:51347106-51347128 GCAGCTGCTGATGTTAAAGCAGG + Intergenic
1176403131 21:6334888-6334910 GCTGCTGGGGAATCTGAGGCAGG - Intergenic
1176434026 21:6654216-6654238 GCTGCTGGGGAATCTGAGGCAGG + Intergenic
1177158080 21:17518994-17519016 GCTGTTGGTAAATCTGAAGCAGG + Intronic
1178057683 21:28817818-28817840 ACAGCTAGTGAATGGGAAGCTGG - Intergenic
1182202400 22:28587126-28587148 GCAGGTGGATCATTTGAAGCCGG + Intronic
1182917464 22:34048331-34048353 CCAGCTGGGAAATGTGAAGCTGG + Intergenic
1183365988 22:37407032-37407054 ACAGATGGACAATTTGAAGCTGG + Intronic
1183960120 22:41406422-41406444 GCAGCTGCTCAATTGGCAGCTGG + Intergenic
1184493381 22:44823484-44823506 GAAGTTGGTGAACGTGAAGCTGG + Intronic
1184890116 22:47374248-47374270 GCAGCTCCTGAAATTGGAGCAGG - Intergenic
949985131 3:9534619-9534641 GCACCTTTTGAATTTGAAGCCGG + Intronic
950315295 3:11996627-11996649 GCATCTGGTCCATTTGAAGCAGG - Intergenic
950405513 3:12801870-12801892 GCTGCTGGTGATTCTGATGCTGG + Intronic
950580905 3:13861505-13861527 GCAGCTGAGGACTTTGAAGAAGG + Intronic
953052547 3:39358898-39358920 GGTGTTGCTGAATTTGAAGCTGG + Intergenic
954252439 3:49378356-49378378 GCTGCTGGGGAATTTGAAGTGGG - Intronic
956311209 3:67882625-67882647 GTAGATGGTGAATTGGGAGCAGG - Intergenic
956529310 3:70200238-70200260 GGAGCTGATGAATTTGAAGCGGG - Intergenic
956862535 3:73339012-73339034 GCAGCTGGTGAGATTGAGGTGGG + Intergenic
959216228 3:103453871-103453893 GCAGCTGGTTAACTTCAGGCAGG + Intergenic
960009444 3:112817513-112817535 TCAGCTGGTGAATAGGAAACAGG - Intronic
960279754 3:115768058-115768080 GCAGCAGGAGAATTTGAAGAAGG - Intergenic
960649156 3:119926910-119926932 GCAGATGGGGAATGTGAAGGTGG - Intronic
962712801 3:138101786-138101808 GGAGCTGATGAATGTCAAGCTGG - Intronic
964152801 3:153548369-153548391 ACAGCTGGTGAATATAATGCTGG - Intergenic
964702016 3:159578693-159578715 GCTGCTGCTGACTTTGAAGATGG - Intronic
965665211 3:171086412-171086434 GCAGCAGCAGAATTTGAACCAGG + Intronic
966833056 3:184027379-184027401 GGTGTTGGCGAATTTGAAGCTGG - Intergenic
966877905 3:184333963-184333985 GCAGTTTGTGACTTTGAGGCTGG + Intronic
967027149 3:185574859-185574881 GTAGCTGGGGAATCTGCAGCAGG + Intergenic
967404689 3:189102324-189102346 GTAGATGGTGAATAAGAAGCTGG - Intronic
972059852 4:34855650-34855672 GCTGCTGGTGAAGTTGATACTGG + Intergenic
974380292 4:61130842-61130864 GCTGCCAGTGAATATGAAGCAGG - Intergenic
974626073 4:64430219-64430241 GCAGAAGGTGAATGGGAAGCAGG - Intergenic
977882222 4:102217974-102217996 GCTGCTGCTGAAATTGAAGCTGG + Intergenic
978155453 4:105485046-105485068 GGTTTTGGTGAATTTGAAGCTGG + Intergenic
978644780 4:110917008-110917030 GCAGCTAGTCAATTAGAAGGGGG + Intergenic
978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG + Intergenic
980602717 4:135045818-135045840 GGTGTTGGTGAATTTGAAGCTGG + Intergenic
983889182 4:173013371-173013393 CCAGCTGGTGAATATAAAGCAGG + Intronic
984885747 4:184447868-184447890 GCAGCAGGAGAATCTGATGCAGG - Intronic
987107340 5:14652950-14652972 GGTGTTGGTGAATTTGAAGCTGG - Intergenic
988219479 5:28324298-28324320 GCAGAAGGTGAATGGGAAGCAGG + Intergenic
988415130 5:30937441-30937463 GCACCTGGAGAATTTATAGCAGG + Intergenic
993413021 5:87595372-87595394 GCAGCCAGTGAATATAAAGCAGG - Intergenic
995013812 5:107287975-107287997 GCAGCAGGAGAATACGAAGCAGG + Intergenic
995260453 5:110098239-110098261 GCACAAGGGGAATTTGAAGCTGG - Intergenic
996396117 5:123015838-123015860 GAAGCTGGTGACTTTGTAGTGGG + Intronic
997316781 5:132943141-132943163 GCAGCTGGTGAATTTGAAGCTGG + Intronic
997379067 5:133422242-133422264 GCCACTGGTGGATTTTAAGCAGG + Intronic
998097050 5:139401928-139401950 GCAGCTGGAGAAAGAGAAGCTGG - Exonic
998595228 5:143522356-143522378 GCAGCTAAGGAAATTGAAGCAGG + Intergenic
998772203 5:145558752-145558774 GCAGCTCTTGACTTTGAAGATGG + Intronic
999026971 5:148244009-148244031 GCCACTGGGGAATTTCAAGCAGG - Intergenic
999090980 5:148935565-148935587 GCAGATGAAGAAGTTGAAGCAGG - Intronic
999563653 5:152833514-152833536 GCAGAAGGTGAAGGTGAAGCAGG + Intergenic
1000065563 5:157690662-157690684 GCAGCTGCTGGAGGTGAAGCTGG - Intergenic
1000703209 5:164478584-164478606 GCAGCCTGTAAAATTGAAGCTGG - Intergenic
1000853124 5:166364429-166364451 TCTGCAGGTGAATGTGAAGCAGG + Intergenic
1001462137 5:171925112-171925134 CCAGCTGGAGACTTTGCAGCTGG - Intronic
1001487889 5:172132846-172132868 TCAGCTGGTGATTTTGGGGCAGG - Intronic
1001749360 5:174117148-174117170 GCAGATGGAGAAAGTGAAGCTGG - Intronic
1003515114 6:6811431-6811453 GCTCCTGGTGATTTGGAAGCCGG + Intergenic
1003832258 6:10024548-10024570 CCTGCAGGTGAATTTGTAGCTGG - Intronic
1003887520 6:10534748-10534770 GCTGCTGGAGAAGTTGAGGCAGG + Intronic
1005387333 6:25298864-25298886 GCTACTCGGGAATTTGAAGCAGG - Intronic
1005926837 6:30451770-30451792 GCAGCTGGTGAATATGTCGCAGG - Intergenic
1008033794 6:46725205-46725227 GCAGCTGGTAAATGTGTTGCTGG + Intronic
1008649262 6:53546424-53546446 TCAGATGGAGAATTTCAAGCAGG - Intronic
1010229039 6:73519176-73519198 GGTGTTGGTGAATTTGAAGCTGG - Exonic
1014619770 6:123652380-123652402 GCAGAAGGTGAAGTGGAAGCAGG - Intergenic
1015512618 6:134053577-134053599 GCAGATGATGACTTTGAGGCAGG + Intergenic
1015673963 6:135723957-135723979 CCATCTTGGGAATTTGAAGCTGG + Intergenic
1016375742 6:143418936-143418958 GCAGCTGGTGAAATTGTTGGAGG - Intergenic
1016643099 6:146373351-146373373 GCAGAAGGTGAAGTGGAAGCAGG + Intronic
1017066744 6:150536125-150536147 ACAGATGGTGGATTTGTAGCTGG + Intergenic
1018049944 6:160000293-160000315 GCAGCAGGTGAAGGGGAAGCAGG + Intronic
1018764735 6:166924650-166924672 ATAGCTGGTGCATTTGATGCTGG - Intronic
1019383434 7:740218-740240 GCACCTGGTGTGTGTGAAGCTGG + Intronic
1021616966 7:22511623-22511645 GGTGTTGGTGAATTTGAAGCTGG - Intronic
1022665074 7:32403078-32403100 GCAGCTGATGATTTAAAAGCTGG - Intergenic
1022759747 7:33334975-33334997 GCAGGTGGTGAAGTGGATGCTGG + Intronic
1022896091 7:34751625-34751647 GCAGCTGGTCCACTTGGAGCAGG - Intronic
1023512819 7:40971150-40971172 GCAGAAGGTGAAGTGGAAGCAGG + Intergenic
1023670467 7:42570998-42571020 GCTGCTGGTGGAGATGAAGCTGG - Intergenic
1023684518 7:42720929-42720951 TCTGCTGCTGAACTTGAAGCTGG + Intergenic
1024151764 7:46578961-46578983 CCAGCTGGTGAATATTAGGCAGG - Intergenic
1024526102 7:50350497-50350519 GCTGCAGGTGACTTTGCAGCTGG + Intronic
1026846990 7:73704004-73704026 GCAGCTGCTGAGTTTGGGGCTGG - Intronic
1027045894 7:74991319-74991341 ACAGCTGGAGAAACTGAAGCCGG + Intronic
1028259099 7:88639367-88639389 GGTGCTGGTGAATCTGAAGCTGG + Intergenic
1028492837 7:91432700-91432722 GCTACTGGGGAAGTTGAAGCAGG - Intergenic
1030128966 7:106180461-106180483 GCAGCTCCTTAATTAGAAGCAGG + Intergenic
1030695478 7:112580616-112580638 GTTGCTGGAGAGTTTGAAGCAGG + Intergenic
1031074435 7:117199241-117199263 GCATCTGGTGATTTTCAAGTGGG - Intronic
1033162289 7:139008420-139008442 GCAGCTTGGGAAGCTGAAGCGGG - Intergenic
1034734971 7:153420316-153420338 GCAACTGGGGAGGTTGAAGCAGG + Intergenic
1034886539 7:154803042-154803064 GAGGCTGGGGAGTTTGAAGCAGG - Intronic
1040064463 8:43133899-43133921 GCTGTTGGTGAGTTTGAAGGTGG - Intergenic
1040579521 8:48685909-48685931 GCAGCTGGTGATAGTGAACCAGG - Intergenic
1041055653 8:53983554-53983576 GGAGCAGGAGAATCTGAAGCAGG + Intronic
1041702198 8:60803546-60803568 TGAGTTGATGAATTTGAAGCTGG + Intronic
1043492207 8:80760825-80760847 GCAGAAGGTGAAGTGGAAGCAGG + Intronic
1046212088 8:111089513-111089535 GCAACTGCAGACTTTGAAGCAGG + Intergenic
1046901638 8:119529869-119529891 TTAACTGGTGAATTTGGAGCTGG + Intergenic
1047978799 8:130158698-130158720 GCCGCTGGAGTATTTTAAGCAGG + Intronic
1048657030 8:136551451-136551473 GCAGAGGTTGGATTTGAAGCAGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049755535 8:144309840-144309862 GCAGCTGATGAAGGGGAAGCAGG + Exonic
1049871643 8:144983420-144983442 GCAGCAGGTGAAGGGGAAGCAGG - Intergenic
1050109710 9:2201736-2201758 GCAGATGGTGAAGGGGAAGCAGG + Intergenic
1051156010 9:14146721-14146743 GCAGCTGGTGAACTTGGAGAGGG + Exonic
1053194292 9:36103640-36103662 GTAGCTGGTAGATTTGTAGCTGG + Intronic
1053194293 9:36103655-36103677 GTAGCTGGTAGATTTGTAGCTGG + Intronic
1054762256 9:69013837-69013859 GAAGGTGGTGAAGATGAAGCAGG - Exonic
1056695547 9:88847257-88847279 GCTGCAGGAAAATTTGAAGCTGG - Intergenic
1060602800 9:124889268-124889290 GCAGCTGGTGTATCTGCAGCAGG + Exonic
1060718424 9:125956254-125956276 GCAGAGCGTGAATTTGAAACCGG + Intronic
1061784672 9:133019840-133019862 GGTGTTGGTGAATTTGAAGCTGG + Intergenic
1203437508 Un_GL000195v1:154450-154472 GCTGCTGGGGAATCTGAGGCAGG - Intergenic
1186001961 X:5022466-5022488 GCAGATGGTGAAGTGGGAGCAGG - Intergenic
1188821284 X:34778432-34778454 CCAGCTGGTGAGTTTGGAGGAGG + Intergenic
1189893767 X:45632592-45632614 GGAGCTGATGAATGTCAAGCTGG - Intergenic
1189966165 X:46376080-46376102 TCAGCAGGTGAATCTGAGGCTGG - Intergenic
1190578409 X:51865946-51865968 GCAGAAGGTGAAAGTGAAGCAGG - Intronic
1192399593 X:70821516-70821538 GCAGATGGTGAAGGGGAAGCTGG - Intronic
1193036430 X:76956536-76956558 GCATTTTCTGAATTTGAAGCTGG + Intergenic
1193820748 X:86161277-86161299 GGTGTTGGTGAATTTGAAGCTGG - Intronic
1193865710 X:86727719-86727741 GCAGCTGGTGAAGTGGGGGCAGG - Intronic
1194134260 X:90120448-90120470 GGAGGTGGTGAATTAGTAGCGGG - Intergenic
1195244528 X:102983529-102983551 GCAGCAGGTGAATTAGTAGATGG - Intergenic
1195905698 X:109842126-109842148 GCAGCTTTTGATTTTGAAGATGG - Intergenic
1196295471 X:113991889-113991911 GCTGCCAGTGAATATGAAGCAGG - Intergenic
1196306811 X:114112421-114112443 GAAGCTGGTGGATTTGATGAAGG - Intergenic
1196838325 X:119833888-119833910 GCAGAAGGTGAAGTAGAAGCAGG - Intergenic
1196865045 X:120063504-120063526 GCTGCCAGTGAATATGAAGCAGG + Intergenic
1196878056 X:120172828-120172850 GCTGCCAGTGAATATGAAGCAGG - Intergenic
1196882567 X:120212028-120212050 GGTGTTGGTGAATTTGAAGTTGG - Intergenic
1197477069 X:126939058-126939080 GCTGCTGGTGAATATAAAGGAGG - Intergenic
1198051556 X:132957116-132957138 GCCGCGGGTGAAATTGTAGCGGG + Exonic
1198619192 X:138487965-138487987 GGAGCTGATGAAATTCAAGCTGG - Intergenic
1200037824 X:153344796-153344818 GAAGGTGGTGAATTTGAGGAAGG - Intronic
1200081543 X:153579189-153579211 GCAGCTGGTGAGGTGGAAGAGGG + Intronic
1200480042 Y:3690560-3690582 GGAGGTGGTGAATTAGTAGCGGG - Intergenic
1201225526 Y:11815039-11815061 GGAGCTGGTCAATGGGAAGCAGG - Intergenic