ID: 997318154

View in Genome Browser
Species Human (GRCh38)
Location 5:132955106-132955128
Sequence GGTTGGAGAGGATTTCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 2, 2: 5, 3: 23, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997318154 Original CRISPR GGTTGGAGAGGATTTCAGCT AGG (reversed) Intronic
900752869 1:4410092-4410114 GGTTGGTGAGAACTTCATCTTGG - Intergenic
901631120 1:10648695-10648717 GCTTGGAAAGGCCTTCAGCTAGG + Intronic
902517987 1:17000152-17000174 GGCAGGAGAGGAGCTCAGCTAGG + Intronic
902664065 1:17925218-17925240 GTTTGGGGAGGAGTTCTGCTGGG + Intergenic
904012572 1:27398288-27398310 GGTTGGTAAGGAGTTGAGCTGGG + Intergenic
905939860 1:41854341-41854363 GGTTGGAAAGGGTTTCAAGTTGG + Intronic
906530381 1:46520366-46520388 GGCTGGAGAGGTCTTCACCTGGG + Intergenic
909597371 1:77421779-77421801 TGATGGAGAGGAGTTCAGCAAGG - Intronic
910488888 1:87746295-87746317 GGTTGGAGAAGAGATCAGCCGGG + Intergenic
912273326 1:108231656-108231678 GGTGGGAGAGCATTTCAGCCTGG - Intronic
912294894 1:108462666-108462688 GGTGGGAGAGCATTTCAGCCTGG + Intronic
917782094 1:178409130-178409152 GGTTGGAGAAGATTGCATCATGG + Intronic
918107658 1:181427564-181427586 AGTTGGAGAGGAGTTGAGGTGGG - Intronic
919150145 1:193686013-193686035 GGGAGGAGAGAATTTCAGGTTGG - Intergenic
919939043 1:202273868-202273890 GGTAGGATAGGATTTCAACAAGG - Intronic
922334306 1:224606435-224606457 GGTTGGAGAGGAGTTCGACTGGG - Intronic
922725008 1:227918520-227918542 GGTTGGAGAGGAGGTGGGCTCGG - Intergenic
923536670 1:234857893-234857915 GGTTGGAGAGGACCAGAGCTTGG + Intergenic
1062868242 10:876006-876028 GGCTGGAGAGGAATTGATCTTGG - Intronic
1067453933 10:46400420-46400442 GTTTGGAGAGGACTTTGGCTGGG - Intergenic
1067453943 10:46400566-46400588 GTTTGGAGAGGACTTTGGCTGGG - Intergenic
1067633258 10:47984061-47984083 GTTTGGAGAGGACTTTGGCTGGG + Intergenic
1067633268 10:47984207-47984229 GTTTGGAGAGGACTTTGGCTGGG + Intergenic
1068359755 10:55962031-55962053 GAGTGGACAGAATTTCAGCTGGG - Intergenic
1069601055 10:69708394-69708416 GGTTGGAGAGGAGTTCAGCTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072452691 10:95551371-95551393 TCTTGGAGAGGATTTTACCTGGG - Intronic
1073070534 10:100790664-100790686 GTTTGGAGAGGATGTAGGCTAGG + Intronic
1075706716 10:124506651-124506673 GGGTAGGGAGGATTTCAGGTTGG + Intronic
1075706764 10:124506799-124506821 GGGTAGGGAGGATTTCAGGTGGG + Intronic
1075706773 10:124506823-124506845 GGGTAGGGAGGATTTCAGGTAGG + Intronic
1075706794 10:124506894-124506916 GGGTAGGGAGGATTTCAGGTTGG + Intronic
1075706802 10:124506918-124506940 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706812 10:124506942-124506964 GGGTAGGGAGGATTTCAGGTGGG + Intronic
1075706826 10:124506991-124507013 GGGTAGGGAGGATTTCAGGTCGG + Intronic
1075706848 10:124507064-124507086 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706862 10:124507112-124507134 GGGTAGACAGGATTTCAGGTCGG + Intronic
1075706870 10:124507137-124507159 GGTTAGAGAGGATTTCAGGTGGG + Intronic
1075706883 10:124507186-124507208 GGATAGACAGGATTTCAGGTGGG + Intronic
1075706905 10:124507260-124507282 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706920 10:124507309-124507331 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706935 10:124507358-124507380 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706957 10:124507432-124507454 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706971 10:124507481-124507503 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075706993 10:124507555-124507577 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075707011 10:124507629-124507651 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075707031 10:124507703-124507725 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075707046 10:124507752-124507774 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075707070 10:124507826-124507848 GGGTAGACAGGATTTCAGGTGGG + Intronic
1075707080 10:124507850-124507872 GGGTAGGGAGGATTTCAGGTGGG + Intronic
1075707097 10:124507899-124507921 GGGTAGACAGGATTTCAGGTGGG + Intronic
1077735305 11:4784187-4784209 TGTTGGCCAGCATTTCAGCTGGG + Intronic
1080573451 11:33577658-33577680 GTGTGGGGTGGATTTCAGCTGGG + Intronic
1081374204 11:42339799-42339821 GGCTGGAAAAGAGTTCAGCTGGG + Intergenic
1083332198 11:61904139-61904161 AATTGGGGAGGATTTCACCTTGG - Intronic
1084354670 11:68629885-68629907 GGCAAGAGAGGATTACAGCTTGG - Intergenic
1084476424 11:69392072-69392094 GGCTGGGGAGGAATCCAGCTGGG + Intergenic
1086428169 11:86707617-86707639 GATTTGAGAGGATTTTATCTGGG - Intergenic
1087241690 11:95789060-95789082 GGGTGGAGATGTTTTCATCTCGG - Intronic
1087753264 11:102028616-102028638 AGTCGGAGAGGAGTTCAGTTGGG + Intergenic
1091663179 12:2399527-2399549 GGTCAGAGAGGAGTTCAGCCGGG - Intronic
1094248270 12:28327936-28327958 GGTGAGATAGGAATTCAGCTAGG + Intronic
1094412591 12:30182845-30182867 AGTTGGAGAGGAGTTCAGCTGGG + Intergenic
1096085938 12:48865199-48865221 GGTTTGAGAGGAGATGAGCTAGG - Intronic
1097626152 12:62002964-62002986 GGGTAGAGAGGATGTCAGATGGG - Intronic
1101377583 12:104184252-104184274 GGTTGGAGAGGAGTTTGGATGGG - Intergenic
1102981271 12:117243473-117243495 TGTTGGAGAGGAGATCCGCTTGG - Intronic
1106627392 13:31434530-31434552 GGTCGGAGAGGAGTTCAGCTAGG - Intergenic
1107655453 13:42588526-42588548 GGTTGGAGAGCATGACAGCAAGG + Intronic
1110603951 13:77409585-77409607 GGTTGGAGAGGAGTAAAGTTGGG + Intergenic
1111210884 13:85077835-85077857 GGTTGGACTTGATTTCAGGTAGG - Intergenic
1114318138 14:21525571-21525593 GGTGGGCGAGGAATTCAGTTGGG + Exonic
1117199275 14:53371770-53371792 GGTTGTATAGGATTTGAGCAGGG + Intergenic
1117727496 14:58688949-58688971 AGTTTGAGAGTATTTAAGCTAGG - Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1119102328 14:71891392-71891414 TGTTGGCGAGGAGCTCAGCTGGG + Intergenic
1119363909 14:74074988-74075010 GGTGGGACTGGATTTCACCTTGG + Exonic
1121849200 14:97204016-97204038 GGAGGGACAGGATTTCAGGTAGG - Intergenic
1122060781 14:99135373-99135395 GGTTGGAGAGAATGTCAGCGGGG + Intergenic
1122949509 14:105033958-105033980 GCTATGAGAGGATTTGAGCTTGG + Intergenic
1124784598 15:32668082-32668104 GGTTGTAGAGGATTTAGTCTGGG + Intronic
1125108386 15:36001444-36001466 TGTTGGAAAGGATTTCATCTTGG + Intergenic
1125592081 15:40860938-40860960 GGGTGGAGGGGATTTAAGCAGGG + Intergenic
1126253161 15:46592600-46592622 GGCAGGAGAGGATTTCAGTGTGG - Intergenic
1126736005 15:51732826-51732848 GGTGGGAGAGGATAGCAGCTGGG - Intronic
1127432756 15:58926983-58927005 GGTTGGACAGTATTCCAGCAAGG + Intronic
1130722284 15:86400310-86400332 GGTTGGAGAGAACTTCACATGGG - Intronic
1132333200 15:101026563-101026585 GTTTGGAGGGGCTTTCAGTTAGG + Intronic
1132353380 15:101154455-101154477 GGTTGGTGAGGAGTGCAGATGGG + Intergenic
1137395162 16:48111959-48111981 GGTTGGAGAGGAGTTTGGCATGG - Intronic
1137791438 16:51177993-51178015 GATTGAAGAGCATCTCAGCTGGG + Intergenic
1140061702 16:71576096-71576118 GGTTGGAGAAGATGGCAGTTGGG - Intronic
1142882446 17:2892374-2892396 TGTGGGTGAGGAATTCAGCTAGG + Intronic
1146797471 17:35793256-35793278 AGATGGAGAGAATTTCATCTTGG - Intronic
1147230884 17:39016921-39016943 GGTTAGAGAGAGTTTGAGCTGGG + Intergenic
1149422616 17:56525613-56525635 GGGTGGAGAGGATTTATTCTTGG - Intergenic
1149722900 17:58863806-58863828 AGTCAGAGAGGAGTTCAGCTGGG - Intronic
1151042623 17:70881243-70881265 TCTTGGAGAGGATTACAGATGGG + Intergenic
1159936734 18:74374573-74374595 GGTTGGAGATGACTTAAGATAGG + Intergenic
1162740750 19:12772320-12772342 GGATGGAGAGGTTCTCAGGTTGG - Intronic
1165434024 19:35787135-35787157 GAATGGAGAGGGGTTCAGCTGGG - Intronic
1168684534 19:58340173-58340195 GGTTGGAGAGCTTTCCACCTTGG - Exonic
925157593 2:1659293-1659315 GGCTGAAAAGAATTTCAGCTAGG + Intronic
927291161 2:21406200-21406222 ATTTGGGGAGGATTTAAGCTGGG + Intergenic
927430879 2:23025270-23025292 GGTTGGAGGGAATTTCAGCAGGG + Intergenic
928375466 2:30769901-30769923 GGATGGGCAGGATTTCAGCAAGG - Intronic
928946315 2:36775045-36775067 TGTTGGAGCGGATGTCAGCCTGG + Exonic
929970096 2:46566682-46566704 GGCTGGAGAGGGAGTCAGCTTGG - Intronic
932120533 2:69095620-69095642 GGTTGGGGAGGAATTCAGTGAGG + Intronic
932398581 2:71464646-71464668 GGCTGGAGAGGAGGTCAGCGAGG + Intronic
933087390 2:78072582-78072604 AGTAGGAGAGGATGTAAGCTGGG + Intergenic
936052260 2:109233371-109233393 GGTCAGAGAGGAGTTCAGCTGGG - Intronic
939500259 2:142975276-142975298 AGTCAGAGAGGATTTCAGCTGGG + Intronic
939522825 2:143253450-143253472 AGTTTGATAGGATTTCAACTAGG - Intronic
943160009 2:184235496-184235518 GGTTGATGAGGAATTCAGCTGGG - Intergenic
943195541 2:184743168-184743190 GATTGGAAAGGATTTCAGTCTGG - Intronic
946100423 2:217315755-217315777 AGTTGGAGAGGAGTTCAGCTGGG + Intronic
947930493 2:233960889-233960911 GGTTGGAGAAGAGTTCAGTGAGG - Exonic
1172845848 20:37929680-37929702 GGTGAGAGAGGATGGCAGCTTGG + Intronic
1173489702 20:43469846-43469868 GGGTTGAGAGGGTTTCCGCTTGG - Intergenic
1175137587 20:56836479-56836501 GGTTGGAAAGGAGGTAAGCTGGG - Intergenic
1175520858 20:59602115-59602137 GGTGAGAGAGGAGTTCAGCCAGG - Intronic
1175639824 20:60619632-60619654 GGCAGGAGAGGATGGCAGCTCGG + Intergenic
1176981515 21:15386731-15386753 GGTTGGAAAGGAGTTCGGCCAGG + Intergenic
1181041680 22:20195338-20195360 GGTTGGGGAGGCTTTTAGGTTGG + Intergenic
1182455094 22:30445239-30445261 GGATGGAGCGGACCTCAGCTGGG + Intergenic
1182902483 22:33909879-33909901 GGTTGGAGAGGAAGCCAGCTTGG - Intronic
1183862421 22:40679600-40679622 GGGTGGAGGGGAGCTCAGCTCGG + Exonic
1184536982 22:45094148-45094170 GGCTGGAGAGGGATTTAGCTGGG - Intergenic
949100175 3:133826-133848 GATTAGAGAGGCTTTGAGCTTGG - Intergenic
949544074 3:5057309-5057331 GGCAGGAGAGGATGGCAGCTTGG + Intergenic
950050340 3:9983831-9983853 GGTTGAAGAGGGTTTAACCTGGG + Intronic
950130972 3:10546493-10546515 GGGTGGAGAGGTTGGCAGCTGGG - Intronic
952039218 3:29241377-29241399 GGTGGGAGAGGAGTTCAGCTGGG - Intergenic
952109766 3:30109058-30109080 GGTTGGAGAGGAGTTTGGCTGGG + Intergenic
959723326 3:109516158-109516180 GGTCAGAGAGGAGTTCGGCTGGG - Intergenic
961235680 3:125364660-125364682 GGTTGGATGAGATATCAGCTTGG + Intronic
962353437 3:134673266-134673288 GGTTGGAGAAGATCTCAGAGAGG - Intronic
962439951 3:135404260-135404282 GGTTGGAGAGGCTTTCTGGAAGG + Intergenic
965017677 3:163179426-163179448 CTTTGGAAAGGATTTCAGGTAGG - Intergenic
969212908 4:5701442-5701464 GGGTGGAGAGCATTTCAGGAAGG - Intronic
970132788 4:12889728-12889750 TGTGGGATAGGATTTCAGCTAGG + Intergenic
970178092 4:13359418-13359440 GGTTAGAGCGGATTTCCGCAAGG + Intergenic
971787521 4:31123906-31123928 GGTTGGAGAGAAGTTCGGCTGGG - Intronic
973854452 4:54996824-54996846 GGTGGGAGAGGATTTGATCATGG - Intergenic
973879364 4:55253818-55253840 GGTTGGAGAGGGGTTCTGTTGGG - Intergenic
975246995 4:72131006-72131028 GGTTGGAGAGGAGTTCAACCAGG - Intronic
977359532 4:95984686-95984708 GGTCGGAGAGGAGATCGGCTGGG - Intergenic
978120244 4:105070551-105070573 GGCTGGACAGGCATTCAGCTAGG - Intergenic
979469792 4:121081650-121081672 GAATGGAGAGGATTTCGACTGGG - Intergenic
979631114 4:122904150-122904172 GGTTGGGGAAGCTTTCAGCCAGG + Intronic
980838991 4:138233949-138233971 GGTTGGAGAAGTTTTCCCCTGGG - Intronic
981623401 4:146729863-146729885 GGTGGGAGGGGATTTGATCTTGG - Intronic
984098066 4:175455567-175455589 TGTTGGAGAGGAGTTCAGCCAGG - Intergenic
986163199 5:5249945-5249967 GGTTGGAGAGGAGTTTGGCTGGG - Intronic
986163207 5:5249971-5249993 GGTTGGAAAGGAGTTCAGCCAGG - Intronic
990238733 5:53795857-53795879 GATGGGAGAGAATTTCTGCTGGG - Intergenic
990895874 5:60699915-60699937 GGGTGTGGAGCATTTCAGCTGGG - Intronic
991094915 5:62729526-62729548 GGTTAATGAGGATTTAAGCTGGG + Intergenic
991658566 5:68927669-68927691 GGTTGGAGAGGAGTTTGGCCAGG - Intergenic
992168043 5:74074247-74074269 AGTTGGAGAGGAATTCGGCTGGG + Intergenic
992582207 5:78191569-78191591 GGATTGAGATGATTTAAGCTGGG - Intronic
993307246 5:86288425-86288447 GGTGGGAGAGCATTTCAGCCTGG + Intergenic
993829888 5:92741992-92742014 GGTTTTAGTGGATTTTAGCTGGG + Intergenic
994081512 5:95712571-95712593 GGTTGGCTAGGACTTCAGCTGGG - Intergenic
995629924 5:114121710-114121732 GGCAAGAGAGGATATCAGCTGGG - Intergenic
996890342 5:128411486-128411508 GGTCAGAGAGGAGTTCCGCTAGG - Intronic
996890346 5:128411512-128411534 GGTTGGAGAGGAGTTCAGCTGGG - Intronic
997318154 5:132955106-132955128 GGTTGGAGAGGATTTCAGCTAGG - Intronic
1000234456 5:159344614-159344636 GGTTGGAGAGGAATTTGGCCAGG - Intergenic
1000742503 5:164987171-164987193 GGTCAGAGAGGAGTTCAGCCAGG + Intergenic
1002932567 6:1644521-1644543 AAGTGGAGAGAATTTCAGCTGGG - Intronic
1002988048 6:2210594-2210616 GGTGGGAAAGGAAATCAGCTAGG + Intronic
1005629034 6:27690267-27690289 AGATGGAGTGGCTTTCAGCTGGG - Intergenic
1008606529 6:53145456-53145478 AATTGGTGAGGATTCCAGCTGGG - Intronic
1009404105 6:63291500-63291522 AGGTGGGGAGGAGTTCAGCTGGG - Intronic
1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG + Intergenic
1019104944 6:169660266-169660288 GGTTGGAGAGGAGTGCGCCTCGG + Intronic
1024656769 7:51457718-51457740 GAGTGGAGAGGATTTGAGATAGG - Intergenic
1026562099 7:71458764-71458786 ACATGGAGAGGAGTTCAGCTGGG - Intronic
1027755779 7:82210393-82210415 TCTTGGATTGGATTTCAGCTAGG + Intronic
1027926183 7:84466786-84466808 GGTAGGAGAGGATCCCAGCTAGG - Intronic
1028730770 7:94146195-94146217 GGTTTCACAGGATTTGAGCTTGG + Intergenic
1029017072 7:97325912-97325934 AGGTCGAGAGGAGTTCAGCTGGG - Intergenic
1029589624 7:101498811-101498833 GGCTGGAGAGGATTTCCCCAGGG + Intronic
1029837364 7:103326810-103326832 GGTTGGGGAGGATTTAATTTAGG + Intronic
1030119410 7:106093081-106093103 GGTTGGTGAGCACTTCAGCCTGG - Exonic
1034288806 7:149910987-149911009 AGCTGGAGAGGACTTCACCTGGG - Intergenic
1035241850 7:157537394-157537416 GGTGGTGGAGGAGTTCAGCTGGG - Intergenic
1035655429 8:1301675-1301697 AGTTGGAGATGATTCCAGGTTGG + Intergenic
1035824423 8:2629220-2629242 GGTCAGAGAGGAGTTCAGCTGGG - Intergenic
1037775822 8:21834986-21835008 GGATGGAGAGGAAGTCAGGTTGG - Intergenic
1038277512 8:26134258-26134280 GGCTTGTGGGGATTTCAGCTGGG + Intergenic
1039290457 8:36088952-36088974 GGTCAGAGAGGAGTTCAGCCAGG - Intergenic
1040893898 8:52345582-52345604 GGTTGGAGATGAAGGCAGCTGGG - Intronic
1041062574 8:54049962-54049984 GGGTGGAGAGAATTTCAGAGTGG - Intronic
1041425897 8:57720133-57720155 GGTGGGAGAGAATTTGACCTTGG + Intergenic
1043083435 8:75796346-75796368 GGTTGGAGATGAGGTCAGATGGG - Intergenic
1045106231 8:98895461-98895483 GGTTAGACTGGATTTGAGCTTGG + Intronic
1045122907 8:99057688-99057710 GGTTTAAGATGATTTCAGTTTGG - Intronic
1046268707 8:111864921-111864943 GGTTGGAGAGGAGGTTATCTTGG - Intergenic
1047705675 8:127497196-127497218 GCTTGGAGAGGATTTCCTTTTGG - Intergenic
1050010639 9:1182512-1182534 GGTAGGAGACGATTTGGGCTTGG + Intergenic
1050706749 9:8408460-8408482 GCCTGGCCAGGATTTCAGCTTGG - Intronic
1050793171 9:9500514-9500536 GGTTGGATAGGGTATCAGGTAGG + Intronic
1052438723 9:28465333-28465355 GGTCAGAGAGGAGTTCAGCCGGG - Intronic
1053150500 9:35740021-35740043 GGGAAGAGAGGATCTCAGCTTGG - Exonic
1054803839 9:69379387-69379409 AGCTGGAGGGGATGTCAGCTGGG + Intronic
1056633322 9:88311512-88311534 GGCTGTAGAGGAACTCAGCTGGG - Intergenic
1056737537 9:89222854-89222876 GTTTGGAGAGGAGGACAGCTGGG - Intergenic
1057921772 9:99104333-99104355 GGTTTGAGAGGAGTGCGGCTTGG + Intronic
1059171178 9:112126625-112126647 ATTTAGAGAGGATTTCAGCACGG + Intronic
1061941750 9:133887637-133887659 GGTTGGGGAGGGTCTCTGCTGGG - Intronic
1185619828 X:1447012-1447034 GGTTTCAGAGGTTTTCAGTTAGG - Intronic
1195100856 X:101552604-101552626 GGTTGGAGAGTCTTTAAGCGGGG + Intronic
1197150267 X:123213139-123213161 GGTTGGGGAGGAGTTCAGGATGG - Intronic
1199196782 X:145041516-145041538 GGTTGGAGAGGGATGAAGCTGGG + Intergenic
1201310880 Y:12597305-12597327 GGTGGGAAAGGAATTCAGCAGGG + Intergenic