ID: 997319025

View in Genome Browser
Species Human (GRCh38)
Location 5:132963159-132963181
Sequence AGGCTCCCCGCAGAACTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997319020_997319025 -7 Left 997319020 5:132963143-132963165 CCGGAGGGTCTCCCCGAGGCTCC 0: 1
1: 0
2: 2
3: 18
4: 179
Right 997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 101
997319017_997319025 -2 Left 997319017 5:132963138-132963160 CCAGCCCGGAGGGTCTCCCCGAG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 101
997319015_997319025 0 Left 997319015 5:132963136-132963158 CCCCAGCCCGGAGGGTCTCCCCG 0: 1
1: 0
2: 1
3: 26
4: 215
Right 997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 101
997319011_997319025 13 Left 997319011 5:132963123-132963145 CCTGATTGAGCAGCCCCAGCCCG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 101
997319016_997319025 -1 Left 997319016 5:132963137-132963159 CCCAGCCCGGAGGGTCTCCCCGA 0: 1
1: 0
2: 0
3: 11
4: 70
Right 997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 101
997319019_997319025 -6 Left 997319019 5:132963142-132963164 CCCGGAGGGTCTCCCCGAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 196
Right 997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG 0: 1
1: 0
2: 1
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997319025 Original CRISPR AGGCTCCCCGCAGAACTTGC GGG Intronic
900549235 1:3245845-3245867 AGGCTCCCTCGAGAACTTGAGGG - Intronic
905897541 1:41558426-41558448 GGGCTCCCCTCAGAAGTTTCTGG - Intronic
906083243 1:43107848-43107870 GGGCTGCGCGCAGCACTTGCGGG - Intergenic
906569064 1:46820774-46820796 TGGCTCCTCCCAGACCTTGCTGG + Intergenic
920065657 1:203267722-203267744 AGGACTCACGCAGAACTTGCTGG - Intronic
921444947 1:215234954-215234976 AAGCTCTCGGCAGAACTGGCTGG + Exonic
924030329 1:239879573-239879595 AGGCTCCCGGGTGAACTGGCTGG + Intronic
1063349653 10:5342454-5342476 AGGCACCCCGGAGAACTGACAGG - Intergenic
1063395782 10:5685548-5685570 AGGCTTCACGCAGAACCCGCAGG - Intronic
1067089473 10:43259271-43259293 AGGCTACCCGCTGTGCTTGCAGG - Intronic
1067912799 10:50363676-50363698 AGGCACCCAGAATAACTTGCAGG + Intronic
1071590991 10:86873081-86873103 AGGCACCCTGCAGAGCTGGCTGG - Intronic
1073983234 10:109178408-109178430 AGGCTCCCTCCAGAACTAGGAGG + Intergenic
1084170988 11:67401060-67401082 GGGCTCACCGCAGATCTTGAGGG + Exonic
1084910130 11:72381592-72381614 AGACTCCCCCCAGAACCGGCTGG + Intronic
1084943480 11:72626573-72626595 AGCCTCACCCCAGGACTTGCTGG + Intronic
1092137398 12:6159498-6159520 GGGCTGCGCGCAGAGCTTGCGGG + Intergenic
1095948090 12:47765326-47765348 AGGCCCCCCTCAGGCCTTGCGGG + Intronic
1101925008 12:108964498-108964520 CGGCTCCCAGCAGACCTTGAAGG - Intronic
1103613445 12:122137845-122137867 AGGCTGCCCGCATCAGTTGCAGG + Intronic
1104671442 12:130683309-130683331 AGGCTCCCCACAGAGCCTCCAGG + Intronic
1105889085 13:24669184-24669206 AGGCACCACCCAGAGCTTGCAGG + Intergenic
1106619150 13:31356951-31356973 GGGGTCCCCACAGACCTTGCAGG + Intergenic
1108685491 13:52815555-52815577 GGGCTGCCCGCAGCGCTTGCGGG - Intergenic
1108826246 13:54416017-54416039 AAGCTCCACACAGCACTTGCGGG + Intergenic
1113858547 13:113464895-113464917 AGCATCACTGCAGAACTTGCTGG - Intronic
1115398602 14:32934959-32934981 CGGCACCCCGCAGAACGTCCAGG + Intronic
1119287294 14:73465985-73466007 AGGCTCAAAGCAGAAGTTGCTGG + Intergenic
1202893765 14_KI270722v1_random:183671-183693 AGCCTCCCCGCAGACCTCCCAGG - Intergenic
1126279184 15:46922984-46923006 TGTCTCCAGGCAGAACTTGCAGG - Intergenic
1127364192 15:58272025-58272047 GGGGTGCCCGTAGAACTTGCTGG - Intronic
1132398370 15:101489978-101490000 CCGCTCCCAGCAGAACTCGCGGG - Intronic
1132864328 16:2086098-2086120 GGGCTCCCGGCAGAGCCTGCTGG + Intronic
1136074237 16:27805958-27805980 AGGCTCCCTGCAGAATAGGCGGG - Intronic
1137559409 16:49493150-49493172 CGGCTCCCCACAGGACTAGCTGG - Intronic
1141353115 16:83317282-83317304 AGGCTTTCAACAGAACTTGCTGG - Intronic
1141883902 16:86878851-86878873 AGCCTCCTCGCCGACCTTGCGGG - Intergenic
1142113872 16:88346362-88346384 CGGCTCCTGGCAGAACTCGCTGG + Intergenic
1142187477 16:88701403-88701425 ACACTCCCCGCAGAACCTGCAGG + Exonic
1142756334 17:2018509-2018531 TGGCTTCTCGCAGAGCTTGCTGG - Intronic
1148747374 17:49926237-49926259 AGTCTCCACCCAGAACTTCCGGG + Intergenic
1150250618 17:63702343-63702365 AGGCTCCCTGCAGTGCTTCCAGG - Intergenic
1151249245 17:72820871-72820893 AGGGTCCCCCCAGCACTTCCTGG + Intronic
1151529166 17:74693372-74693394 TGGATCCCCTGAGAACTTGCAGG + Intronic
1157858403 18:51121256-51121278 GGGCTGCCCGCAGCGCTTGCAGG - Intergenic
1161574933 19:5049886-5049908 AGGCTGCCCTCCCAACTTGCAGG + Intronic
1162987072 19:14277648-14277670 GGGCTGCCCGCTGCACTTGCAGG + Intergenic
1163003259 19:14382026-14382048 TTGCTCCCCGCAGACCTGGCTGG + Intronic
1163318379 19:16556936-16556958 AGGTTCCCCGCAGAAGCTGCAGG - Intronic
1164720988 19:30431369-30431391 AGCCTCAGCGCAGAAATTGCAGG + Intronic
1166175652 19:41067400-41067422 GGGCTCGACGCAGAACATGCAGG + Intergenic
925375907 2:3385787-3385809 AGTCTCCCAGCAGGACTTGAAGG - Intronic
926316445 2:11713956-11713978 AGATTGCCCGCAGCACTTGCTGG + Intronic
927218684 2:20686189-20686211 AGGCTCAGCATAGAACTTGCTGG + Exonic
937256595 2:120560446-120560468 AGGCTCCCTGCAGCACTTTCAGG + Intergenic
940145820 2:150542882-150542904 GGGCTGCCCGCGGCACTTGCGGG - Intergenic
947698692 2:232214832-232214854 AGGCTCCCAGCAGATCCTGCAGG + Intronic
948806701 2:240456216-240456238 AGGAGCCCCTCAGAACCTGCAGG + Intronic
1174268753 20:49351425-49351447 AGGCTCCCAGCAGCCCTTGATGG + Intergenic
1175265948 20:57703593-57703615 AGGCCCACCGCAGACCTGGCTGG - Intronic
1180981820 22:19881924-19881946 AGGCTCCAGGCAGACCCTGCAGG - Intronic
953737805 3:45511285-45511307 AGGCTTTCCCCAGAACTGGCAGG - Intronic
953874636 3:46659622-46659644 AGGATCCCAGGAGAACTGGCAGG + Intergenic
954040974 3:47887228-47887250 GGGCTGCGCGCAGCACTTGCGGG + Intronic
958773125 3:98449555-98449577 AAGTTCCAGGCAGAACTTGCAGG - Intergenic
960707763 3:120496696-120496718 AGGCTGCCCTGAGAACTTGGGGG - Intergenic
963697837 3:148584407-148584429 AGTCTCCCCACAGTACTTGAAGG + Intergenic
965237279 3:166141297-166141319 AGGCTACCTGCAGAACTTTTTGG - Intergenic
969308244 4:6337609-6337631 AGGTTCCCAGCAGGACTTGCGGG + Intronic
969460967 4:7328787-7328809 GGGCTACCCTCAGCACTTGCTGG + Intronic
973817547 4:54632559-54632581 GGGCTGCCGGCAGCACTTGCGGG + Intergenic
977929645 4:102737123-102737145 AGGCACCCAGCAGAACTGGAGGG + Intronic
978080216 4:104582005-104582027 GGGCTGCCCGCGGCACTTGCGGG + Intergenic
978619145 4:110622114-110622136 TGGCTCCCCGCAGAACTTCCGGG - Intronic
978918007 4:114148895-114148917 GGGCTGCGCGCAGAGCTTGCGGG - Intergenic
979489431 4:121308393-121308415 AGGCTCCGGGCTGAATTTGCAGG - Intergenic
981910080 4:149969049-149969071 AGGCTCGGCATAGAACTTGCTGG - Intergenic
984713274 4:182903645-182903667 AGGCTTCCCTCAGAGCCTGCAGG - Intronic
995288787 5:110425174-110425196 AGGCTTCCACCAGAACTTTCAGG - Intronic
997319025 5:132963159-132963181 AGGCTCCCCGCAGAACTTGCGGG + Intronic
999642016 5:153681595-153681617 TGGCTCCACGCAGAACTATCTGG + Intronic
1001819666 5:174700038-174700060 AGGCTCTCAGCAGAACTGGCTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1014240708 6:119015347-119015369 AGGCTGCACGCAGCACTTGCGGG + Intronic
1016112803 6:140246696-140246718 GGGCACACCGCAGGACTTGCAGG + Intergenic
1018758083 6:166866809-166866831 AGGGTCCCTGCAGAAGTAGCTGG + Intronic
1023983916 7:45084481-45084503 AGACTCTCCTCAGAACTTGAAGG - Exonic
1024286646 7:47763510-47763532 AGGCACCACACAGAGCTTGCTGG + Intronic
1026439655 7:70432965-70432987 AGGCTCCCCACACAACATGCCGG - Intronic
1031336497 7:120539511-120539533 AGGCTCTCCACGGCACTTGCTGG + Intronic
1034541923 7:151763879-151763901 AGGCTCCCCTTGGAGCTTGCAGG + Intronic
1034739894 7:153463995-153464017 AGGCTCCCAGAAGCACTGGCAGG - Intergenic
1035665513 8:1377076-1377098 AAGCTCCCTGCAGAAGTGGCAGG - Intergenic
1041879723 8:62735921-62735943 AGGCTCCCAGCAGAGCCTCCTGG + Intronic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1049052599 8:140210498-140210520 AGGCTTCCCGGAGAACCGGCTGG - Intronic
1049807396 8:144547189-144547211 AGGCTTCCCCCAGATCCTGCTGG - Exonic
1050941972 9:11471664-11471686 AGACTCCACCCAGAACTGGCAGG - Intergenic
1057129373 9:92642332-92642354 AGGCTGCAAGCAGACCTTGCCGG + Intronic
1061294431 9:129669238-129669260 AGGCTCCCTCCAGAAATGGCCGG + Intronic
1061780008 9:132989839-132989861 ACGCTTGCCGCAGAACTGGCAGG - Exonic
1062388298 9:136323819-136323841 TGGCTCCCTGCAGAGCTTGTGGG + Intergenic
1062517456 9:136943715-136943737 AGGCGCCCCTCAGAGCTTGGAGG - Intronic
1062689888 9:137836156-137836178 AGGGTCTCTGCAGAACTTGCAGG + Intronic
1203490815 Un_GL000224v1:102866-102888 AGCCTCCCCGCAGACCTCCCAGG - Intergenic
1203503439 Un_KI270741v1:44744-44766 AGCCTCCCCGCAGACCTCCCAGG - Intergenic
1189896866 X:45665106-45665128 GGGCTGCCTGCAGCACTTGCAGG - Intergenic
1195718451 X:107841524-107841546 AGGCTCCAGGAAGAGCTTGCAGG - Intronic
1196762012 X:119208811-119208833 GGGCTGCACGCAGCACTTGCGGG - Intergenic
1198331387 X:135626126-135626148 AGTCTCCAGGCAGGACTTGCGGG + Intergenic
1199318739 X:146412955-146412977 AGGTTCCTTTCAGAACTTGCAGG + Intergenic
1199553496 X:149081229-149081251 AGCCTCCCCACAGGACTTTCAGG - Intergenic