ID: 997328030

View in Genome Browser
Species Human (GRCh38)
Location 5:133038155-133038177
Sequence GTTCCATGTATGGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997328026_997328030 -3 Left 997328026 5:133038135-133038157 CCTTTTTATAGCTCAATAATGTT No data
Right 997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997328030 Original CRISPR GTTCCATGTATGGCTGGGCA TGG Intergenic
No off target data available for this crispr