ID: 997334843

View in Genome Browser
Species Human (GRCh38)
Location 5:133099951-133099973
Sequence CAGGGAATGCAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997334838_997334843 -8 Left 997334838 5:133099936-133099958 CCTGCCCTAAAGGCACAGGGAAT 0: 1
1: 0
2: 3
3: 8
4: 125
Right 997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG 0: 1
1: 1
2: 1
3: 34
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997334843 Original CRISPR CAGGGAATGCAGCTGGAGCA GGG Intronic
900175141 1:1288183-1288205 CAGGGAATGGAGCGGGGACACGG - Intronic
900456642 1:2778117-2778139 CAGGGCAGGCTGCTGGACCAGGG - Intronic
900551622 1:3259278-3259300 CAGGGGCTGCAGCTGGGGCTGGG + Intronic
900862176 1:5241573-5241595 CAGGGAGGGCAGCTGGCCCAGGG - Intergenic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903450763 1:23452306-23452328 CAGAGAAAGCAGCTCGAGTATGG + Intronic
905795727 1:40815464-40815486 TCGGGACTGCAGCTGAAGCAGGG - Intronic
905907217 1:41627113-41627135 CAGGGCATGCAGATGGCACAGGG + Intronic
906321859 1:44822297-44822319 GAGGGGATGCAGCAGCAGCAGGG + Exonic
907914986 1:58860433-58860455 CTGAGAATGCATCTGGGGCATGG + Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
911499741 1:98670418-98670440 CTGGAAATGCAGCTGCAGAAAGG + Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912887359 1:113488958-113488980 AAGGGAATGCAGCTGGAGCAGGG - Intronic
913083543 1:115412856-115412878 CTGGGAAGGCAGCTGAAGAATGG + Intergenic
915313482 1:155015979-155016001 CAGGGGGTGGATCTGGAGCATGG + Intronic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
916058373 1:161083249-161083271 GGGGGTATGCAGCTGGAGGAGGG - Intronic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
917707072 1:177645575-177645597 CATGGAATCCAGCTGCAGCAGGG + Intergenic
917913832 1:179679973-179679995 CATGGAATGCAGCAAAAGCAGGG - Intronic
918425499 1:184405586-184405608 CAGAGAATGCAGCTGATGAAGGG + Intronic
920965080 1:210694595-210694617 CAGGGAATCCCCCTGGAGCTGGG + Intronic
922090308 1:222389478-222389500 CAGGGCATGCTGCCGGAGCTGGG - Intergenic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
922751995 1:228074367-228074389 CAGGGAGTGCACCTGGAGGGTGG + Exonic
922915371 1:229253015-229253037 CAGGGACAGCAGCCGGGGCAGGG - Intergenic
923218331 1:231870535-231870557 GTGGGAAGGCGGCTGGAGCAGGG + Intronic
923319598 1:232817623-232817645 GAAGGAATGCAGTTGAAGCATGG - Intergenic
1062862999 10:824667-824689 CAGGCACTGCAGGTGGAGCCTGG - Intronic
1065149314 10:22805985-22806007 CAGTGAATGCACCTGTACCAGGG + Intergenic
1065607045 10:27428772-27428794 AAGGTAATGTAGCAGGAGCAAGG - Intergenic
1067292337 10:44952794-44952816 CTGGGAAGGCAGCTTGGGCATGG + Intergenic
1067718429 10:48707797-48707819 CAGGGAATGCGAATGGAGAATGG + Intronic
1067969684 10:50955148-50955170 CAGAGAAAGAAGCTGGTGCATGG + Intergenic
1069142174 10:64840173-64840195 CAGAGAGGGGAGCTGGAGCAGGG - Intergenic
1069655680 10:70086406-70086428 CAGGGAATGCAGATGATGCTTGG - Intronic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1070406231 10:76099561-76099583 CATGGGATGCAGCTAAAGCAGGG - Intronic
1070710194 10:78675703-78675725 CAGGGAGGGCAGCAGGAGCCAGG - Intergenic
1070725107 10:78782427-78782449 CAGGGAATGCTGCTCCAGCTTGG + Intergenic
1070961339 10:80502212-80502234 CAGGGAGTGGCGTTGGAGCAGGG + Intronic
1071191157 10:83102684-83102706 AAGGCAATGCAGCTGGTCCAGGG - Intergenic
1071370903 10:84950590-84950612 CAGGTAATGCTTCTGGAACAGGG + Intergenic
1071417627 10:85455950-85455972 CAGGTAATTCAGCTGCAGGACGG + Intergenic
1071765117 10:88655344-88655366 CATGGCATGCAGCTGGAGACTGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1072633867 10:97164952-97164974 CGGGGAGGGCACCTGGAGCAGGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1073950453 10:108803125-108803147 CAGAAAATGAAGCTGGAGCAGGG + Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1074825866 10:117215597-117215619 CAGGGGATGGAGTGGGAGCATGG - Intergenic
1075147785 10:119897194-119897216 GAGGGAATGAGGCAGGAGCAGGG + Intronic
1075295248 10:121269696-121269718 CTGGGAAGCCACCTGGAGCATGG + Intergenic
1075603241 10:123786396-123786418 CAGGGAAGGCAGCTGGAAGCAGG - Intronic
1075731684 10:124640191-124640213 CTGAGAATGCACCTGTAGCAAGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1077237712 11:1489880-1489902 CTGGGAATGCAGGGGGAGCCTGG - Intronic
1077911251 11:6572832-6572854 CAGCGTATGCAGCCAGAGCATGG + Intronic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1079003811 11:16778877-16778899 CAGGGAATCCGGCCGGAGGAAGG - Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079404193 11:20130732-20130754 CAGGGAATGCAGCAAGTTCATGG - Intergenic
1081999914 11:47388602-47388624 AAGGGCATGCAGCTGGATAAGGG + Intergenic
1082066792 11:47907521-47907543 CAGGGAATGTTTCTGGACCAAGG + Intergenic
1082655777 11:55855586-55855608 CAGATAATGGAGCTGGAGAATGG + Intergenic
1082894896 11:58179688-58179710 CTGGCAGTGCTGCTGGAGCATGG + Exonic
1083880025 11:65543788-65543810 CAGTGAAAGCGGCTGGGGCAGGG - Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084215367 11:67644561-67644583 CAGGGAAGGCAGCAGGGCCAGGG + Intronic
1084533704 11:69744701-69744723 CAGGGAAAGAAGCTGGGTCAGGG - Intergenic
1084564967 11:69923501-69923523 CATGAAATGCAGCTGGAGCTAGG + Intergenic
1085022295 11:73217422-73217444 CAGGGAATGGAACTGGGTCAAGG + Intergenic
1085458489 11:76679112-76679134 CAGCGAATGGAGCTGGAGTAGGG - Intergenic
1085521369 11:77140684-77140706 CAGGGAGTGCAGCTGGGGCTTGG + Intronic
1088976857 11:114823405-114823427 GAGGCAGTGTAGCTGGAGCATGG - Intergenic
1089379613 11:118018353-118018375 TAGGGAATGATGCTGGAGAAGGG + Intergenic
1090040960 11:123291147-123291169 CAGGGCAGGCAGCTGGAACGGGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090413321 11:126523711-126523733 CAAGGAAGGCAGCGGCAGCAGGG - Intronic
1090426124 11:126608148-126608170 CCAGGAATGCAGCTGGAGGTGGG + Intronic
1092017424 12:5170735-5170757 CAGGGAATCTAGCTGGAGGGAGG + Intergenic
1092131160 12:6114214-6114236 CAGGGACTGTGGCTGGAGAATGG + Intronic
1092261546 12:6955795-6955817 GAGGGGAGGCAGCTGGGGCAGGG - Intronic
1092460104 12:8678794-8678816 CATGGATTCCAGCTGGTGCAGGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095183904 12:39178804-39178826 CAGGACATGCAACTGGGGCATGG - Intergenic
1096407416 12:51354101-51354123 TAGGGAAGGCAGCTGGGGGAGGG - Exonic
1096434635 12:51578557-51578579 CAGGAAATGCAGCTTTAACAAGG + Intergenic
1096541710 12:52311586-52311608 CATGGAATGGAGTTGGAGCTGGG + Intergenic
1096553934 12:52391646-52391668 CAGGGAGTGGAGCTGGATCCAGG + Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1101310294 12:103572407-103572429 CAAGGAATGGAGATGGAGTATGG + Intergenic
1103016775 12:117500804-117500826 CAGGACATGCAGCAGGAGCTGGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103877551 12:124140419-124140441 CAGGGAATGCTGGGGGACCATGG + Intronic
1103923234 12:124410353-124410375 CAGGGAAGGCAGCTGGTGAGTGG - Intronic
1104010685 12:124927985-124928007 CTGGGAATGCAGGTTCAGCAGGG + Intergenic
1104957152 12:132472529-132472551 TAGGGAGAGCAGCTGGAGCCGGG + Intergenic
1105354543 13:19646977-19646999 CAGGACATGGGGCTGGAGCATGG + Exonic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105479609 13:20762292-20762314 CTGGGGATGCTGCTGAAGCAGGG - Intronic
1106120755 13:26858436-26858458 CAGAAAATGGAGCTGGAGCAGGG + Intergenic
1107451356 13:40512928-40512950 CATGGGATGGAGCTTGAGCAAGG - Intergenic
1107805746 13:44152402-44152424 GAGGGGATGCAGCTGGAGAGAGG - Intronic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1113505722 13:110814276-110814298 CAGGGAATGTACCTGGATCATGG + Intergenic
1113607377 13:111619993-111620015 TAGGGAAAGCAACAGGAGCAGGG - Intronic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1117744196 14:58851233-58851255 AAGGGAATGAAACTGGAGGATGG - Intergenic
1118311297 14:64695269-64695291 CAGGGAGTGGGGCTGGAGGAAGG + Intergenic
1118597384 14:67446432-67446454 CATGGAATGCATCTGGCTCAGGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119521849 14:75292298-75292320 CAGAGCCTTCAGCTGGAGCATGG + Intergenic
1119552689 14:75526337-75526359 AAGGGAATGTTTCTGGAGCAAGG - Intronic
1120192200 14:81449809-81449831 CAGGGAATGCTGCTGGTCCAGGG + Intergenic
1120866437 14:89299315-89299337 CAGGCAAGACAGCTTGAGCAGGG - Intronic
1121484828 14:94306486-94306508 CCTGGGATGCAGCTGGACCATGG + Intronic
1121581431 14:95035060-95035082 CAGAAAAGGCAGCTGCAGCAGGG + Intergenic
1122135464 14:99630305-99630327 CAGGGACTGCAGATGGACCAGGG - Intergenic
1122168196 14:99847013-99847035 CATGGGATGCAGCTAAAGCAGGG - Intronic
1122579212 14:102761211-102761233 CGGGAAGTGGAGCTGGAGCAGGG - Intergenic
1123053930 14:105560450-105560472 CAGGGACTGCGGATGGGGCAAGG - Intergenic
1123485828 15:20737520-20737542 CAGGGGATGAGGCAGGAGCATGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1123871946 15:24584490-24584512 CAGGGAAAGCTACTGAAGCAAGG + Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1125514339 15:40309355-40309377 CGGGGGATGGAGCCGGAGCAGGG + Intergenic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1126281585 15:46957874-46957896 CAGGGAATGAAGCAGGAACCAGG + Intergenic
1128706097 15:69838398-69838420 CAGGGAAGGGAGCTGGGGGAGGG - Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129312943 15:74725165-74725187 TAGGGGATGGAGCTGGAGCCTGG + Intronic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1130093634 15:80840568-80840590 CAGGGAATGCTGTAGGAGCCAGG - Intronic
1130251843 15:82304872-82304894 CAGGTACTGCAGCTGCAGGAGGG + Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1132536334 16:482936-482958 CAGGAAAGTCAGCTGGAACAGGG - Intronic
1132607923 16:801182-801204 CAGGGGATCGGGCTGGAGCAGGG - Intergenic
1134234322 16:12453517-12453539 CATGGAGTCCAGCTGGAGTAAGG + Intronic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1136631342 16:31490788-31490810 CAGGGCAGGAACCTGGAGCAAGG - Exonic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1138414294 16:56862551-56862573 CAGGGAAGGCTTCTGGAGGAGGG - Intergenic
1138597140 16:58035078-58035100 AAGGGAATGCAGCTGGAGGCCGG - Intronic
1139231089 16:65283257-65283279 CAGAGGATGCAGCTGGGGCCAGG + Intergenic
1139492339 16:67293003-67293025 GAGGAAATGCAGCAGGAGCTAGG - Intronic
1139665320 16:68451052-68451074 CAGGGAAGGCAATTGGAGCTGGG + Intergenic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1141461707 16:84181767-84181789 CAGGCAATGCAGGTGGAGAAAGG - Exonic
1141657716 16:85424974-85424996 CATGCCAGGCAGCTGGAGCAGGG + Intergenic
1141672893 16:85502124-85502146 GAGGGAAGGCAGCTGGAGGTTGG + Intergenic
1141744609 16:85917121-85917143 CAGGGAATGCAGATGGACTCAGG + Intronic
1142068571 16:88076620-88076642 CCGGAGATGCAGCTCGAGCACGG + Exonic
1142227678 16:88885481-88885503 GATGCCATGCAGCTGGAGCAGGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1142873081 17:2833916-2833938 CAGGGAATGCAACCACAGCAAGG - Intronic
1143345645 17:6246888-6246910 CAGGGAAAGGAGCTGAGGCAAGG - Intergenic
1144275958 17:13668180-13668202 CAGGGAGTGAAGCTGGGCCACGG - Intergenic
1144476552 17:15593988-15594010 CAGGGAAAGTAGCTGCAGAATGG - Intronic
1144955824 17:19018331-19018353 AAGGGGATGAAGCTGGGGCATGG - Intronic
1146517958 17:33503984-33504006 GAGGAAATGCAGCTGGAGCTGGG + Intronic
1146890591 17:36504038-36504060 CAGGGCAGGCACCTGCAGCATGG + Intronic
1147162059 17:38574088-38574110 CAGGGAATCCAGTGGGAACAGGG - Intronic
1147657558 17:42099208-42099230 CCGGGAAGGCAGCTGGAGATGGG + Intergenic
1147661868 17:42121142-42121164 CTGGGGCTGCAGCTGGGGCAGGG + Exonic
1147711734 17:42471784-42471806 CATGGAAAGGATCTGGAGCAAGG + Intronic
1148233957 17:45955158-45955180 GAGGGAAGGCAGCTGGACAAGGG - Intronic
1148328818 17:46800625-46800647 ATGAGAATCCAGCTGGAGCAGGG + Intronic
1148345577 17:46901485-46901507 GAGCCAATGCAGCTGGAGCTGGG + Intergenic
1148520139 17:48265837-48265859 CAGGGGAGGCATTTGGAGCATGG - Intronic
1148872015 17:50663852-50663874 CAGGAAGGTCAGCTGGAGCAGGG + Exonic
1149996969 17:61410642-61410664 CGCCGAATGCGGCTGGAGCAGGG + Intergenic
1150673314 17:67221586-67221608 CAGGCTATGCAGCTGGAGAGTGG - Intronic
1151766621 17:76136440-76136462 CAGGGAGTCCGGGTGGAGCAAGG + Exonic
1151955111 17:77376277-77376299 CCGGGAGTGCAGCTGGTCCACGG + Intronic
1152220622 17:79063217-79063239 CAGGTAGTTCAGCTGGAGCCAGG + Intergenic
1152575538 17:81139230-81139252 CAGGCATGGCATCTGGAGCAGGG - Intronic
1153795010 18:8613694-8613716 CATGCAATGCTGTTGGAGCAAGG - Intronic
1154162609 18:11991197-11991219 CAGGGAATGCAGCTGGGATGTGG + Intronic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157600384 18:48889757-48889779 CCAGGAAGGCAGCAGGAGCAGGG - Intergenic
1157713634 18:49867067-49867089 CAGGGAAGGAAGCTGGATCCAGG + Intronic
1158600427 18:58851702-58851724 CAGTGAATGAAGTTGGAGGAAGG + Intergenic
1158653127 18:59305506-59305528 CTGGACGTGCAGCTGGAGCAGGG + Intronic
1160294923 18:77629300-77629322 CACACAATGCAGCTGGAGGAAGG + Intergenic
1160628530 18:80229516-80229538 CAGGGAATGCTTCTGGTTCAAGG - Intronic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161731679 19:5964628-5964650 CAGGGAATGCTGCTGGGAGAGGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162265844 19:9573546-9573568 GAGGGAATGCAGCAAGTGCAAGG + Intronic
1162589137 19:11579111-11579133 CACGGACTGCAGCTGCAGCTGGG + Intronic
1163000480 19:14363693-14363715 CAGGCAGGGCAGCTGGAGCCGGG - Intergenic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163703857 19:18800992-18801014 GAGGGGACGCAGCTGGGGCACGG - Intergenic
1165245724 19:34497466-34497488 CAGGGACGGCAGCTGAAGCCAGG + Intronic
1165708321 19:37991899-37991921 CAGGTCATGCAGCTAGTGCAGGG - Intronic
1166065503 19:40356128-40356150 CAGGGAAAGCAGCTGTGGGAGGG + Intronic
1166369628 19:42293684-42293706 CAGGGGCTACAGCTGGAGCTGGG - Exonic
1168254401 19:55157830-55157852 CTGGTGATCCAGCTGGAGCAGGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
925189243 2:1869394-1869416 CAGGGAATGCAGCTGGCTACTGG - Intronic
925615540 2:5741296-5741318 AAGGGTCTGAAGCTGGAGCACGG - Intergenic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
926673226 2:15594828-15594850 CATGTAATGCAACTGGAGCATGG - Intronic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
927504423 2:23603782-23603804 CCGTGAATGCAGCTGCACCAGGG - Intronic
930729125 2:54710358-54710380 CAGGCACTCCAGCTGCAGCAGGG - Intergenic
931090236 2:58877828-58877850 CAGGAAATGGAGGTAGAGCATGG + Intergenic
931542683 2:63346794-63346816 GAGGGAATGCAAGTGGAACATGG - Intronic
932024168 2:68116745-68116767 CAGGGCAGGCAGCTGGGCCAGGG - Intergenic
932668704 2:73718616-73718638 CAGGGAATGAGCCTGGAGCAAGG + Intergenic
932758988 2:74427314-74427336 AAGGGAATGTAGCAGGAGAAAGG - Intronic
933277934 2:80302965-80302987 CAGGGACTGCAGGTGCGGCACGG + Exonic
933421549 2:82052763-82052785 CTGGGAATGCATCTGGTTCAGGG + Intergenic
934937644 2:98476919-98476941 CAGGCCATGCCGCTGGATCAAGG - Intronic
936264533 2:110992635-110992657 GAGGTAAGGCAGATGGAGCATGG + Intronic
936634912 2:114244916-114244938 CTGGGAAAGCAGCTGGGGCTAGG - Intergenic
940423916 2:153509382-153509404 CGGGGACTCCAGCTGCAGCAGGG - Intergenic
941013747 2:160331271-160331293 CAGGAAATTAAGGTGGAGCAGGG - Intronic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
943541343 2:189218472-189218494 CAGAGCCTGCAGATGGAGCATGG + Intergenic
945471297 2:210230347-210230369 CTGGGATTGGAGCTGGAGCTTGG + Intergenic
946020094 2:216634660-216634682 CAGGGAATGCAGCCGGCGATCGG - Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
947105377 2:226663064-226663086 CAGGGAACCCAGGTGGTGCAGGG + Intergenic
947729660 2:232420923-232420945 CAGAGAAGGCAGCGGGAGCGGGG - Intergenic
948780554 2:240319131-240319153 GAGGGAATGAGGCTGGAGGAGGG + Intergenic
949059334 2:241947636-241947658 CGGGGAATGGGGCTGGGGCAGGG + Intergenic
1168860778 20:1044618-1044640 CAGGGCATGGAGGTGGAACAGGG - Intergenic
1169233776 20:3912121-3912143 CAGGGAATGTACTTGGAGAAGGG + Intronic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1169792233 20:9423606-9423628 TGGGGAATGCAGATGGATCATGG + Intronic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1171394112 20:24820037-24820059 CAGGGACTGGGGCTAGAGCACGG - Intergenic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172104513 20:32508702-32508724 CTGGGAGTCCAGCTGGGGCAGGG - Intronic
1173137250 20:40449431-40449453 TAGGGAATGCATATGCAGCAAGG - Intergenic
1173407223 20:42777166-42777188 CAGGGAGTGCTGCTGGAGAAGGG - Intronic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175842731 20:62040452-62040474 CCGGGGAGGAAGCTGGAGCAGGG + Intronic
1176039163 20:63055286-63055308 CAGGGAAAGCTGCTGGACCGGGG - Intergenic
1176271492 20:64237368-64237390 CTGGGACTGCAGCTGCACCATGG - Exonic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1177149348 21:17438962-17438984 AATGAAATGCAGCTGGAGGATGG - Exonic
1177274763 21:18895764-18895786 CTCTGAATCCAGCTGGAGCAGGG - Intergenic
1177769873 21:25502491-25502513 CAGGCAATGGAGCTTGTGCAGGG + Intergenic
1178594499 21:33940864-33940886 CAGGGGAGGCAGCTGGTGCCAGG + Intergenic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179798546 21:43799639-43799661 CAGGGAACCCACCTGGAGAACGG - Exonic
1180072690 21:45444256-45444278 CTGGGCTTGCAGCAGGAGCACGG + Intronic
1181109379 22:20592258-20592280 CAGGGTGGGCAGCTGGGGCAGGG + Intergenic
1181320059 22:21997681-21997703 CAGGAAATGCACCTGAACCAAGG + Intergenic
1181659896 22:24338393-24338415 GAGGAATTGCAGCTGCAGCAGGG - Exonic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1183086976 22:35492339-35492361 CAGAGAATACACCTGGAGCAGGG - Intergenic
1183460026 22:37944260-37944282 CAGGGAAAGCAGGTGTATCAGGG + Intronic
1183492738 22:38125375-38125397 GAGGGAATGCTGATGGGGCAGGG + Intronic
1183524175 22:38314050-38314072 CAGGGGCTCCAGCTGGAGCTAGG + Intronic
1183981185 22:41541361-41541383 CAGGGACTGCAGCTGGCAGAGGG + Intronic
1184201844 22:42974924-42974946 CAAGGCAGCCAGCTGGAGCAAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185141778 22:49106643-49106665 CAGGGACTGCAGCTGGCTCAAGG - Intergenic
950029091 3:9840188-9840210 CAGTGGCTGCAGCTGGACCAGGG + Exonic
950122761 3:10492715-10492737 CAGGAAAGGCAGGTGGATCAAGG + Intronic
951029846 3:17869479-17869501 CATGGAATGAAGCTGGACCTGGG - Intronic
951527710 3:23669812-23669834 CTGGGCATGGGGCTGGAGCAGGG - Intergenic
951898422 3:27633058-27633080 CAGGGCCTGCAGCGGGAGCTGGG + Intergenic
952419401 3:33117820-33117842 CAGGCTCTGCAGCTGGAACATGG - Intronic
952646697 3:35668405-35668427 CAGAGACTCCAGCAGGAGCAAGG - Intronic
953449987 3:42997854-42997876 CAGGGAAGGCAGCCAGTGCAGGG + Intronic
953687601 3:45090311-45090333 AAGGGAATGCAGGTGTGGCAGGG - Intronic
956384562 3:68703032-68703054 CAGTGAATGCAGGCAGAGCAAGG + Intergenic
956452233 3:69386143-69386165 CAGGGCATGCCGCCGGAGCCTGG - Intronic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
961012820 3:123447733-123447755 CAGGTAGGGCAGCTGGAGCGGGG + Exonic
961115003 3:124321825-124321847 AAGGCAATGCACCTGCAGCATGG - Intronic
961880279 3:130056860-130056882 CAGGGCATGCTACTGGGGCATGG - Intergenic
962990399 3:140572617-140572639 CAGGTGATGCAGCTGGCCCAGGG - Exonic
965391166 3:168106096-168106118 GGGGGAATCCAGGTGGAGCATGG + Intergenic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968622504 4:1610277-1610299 CAGGGGAGGCAGCTGGAGTCTGG - Intergenic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969401247 4:6957021-6957043 CTGGGAGTGGAGCAGGAGCATGG + Intronic
969450215 4:7268719-7268741 CAGGGAGTGGAGGAGGAGCAGGG + Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969902090 4:10359508-10359530 CAACGAATGCAGCAGGACCATGG - Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
971261742 4:25063482-25063504 CAGGGAATGGAGCAGAAGAATGG + Intergenic
971813005 4:31452184-31452206 CAGGGAAAGCATCTGCATCAGGG + Intergenic
973686615 4:53377105-53377127 CAGGATATGCATCTGTAGCAAGG + Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975374092 4:73622138-73622160 CAGACAATGGAGGTGGAGCATGG - Intergenic
975652579 4:76608944-76608966 CAGGTAATGCTGCTGGTCCAGGG - Intronic
977774341 4:100900289-100900311 CAGTGGGTGCAGCTGAAGCAGGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
981571297 4:146153519-146153541 CAGAGAATGCAGCTAGTGCGTGG - Intergenic
982117220 4:152107707-152107729 CAGGCACTGCATCTGAAGCACGG - Intergenic
983146550 4:164223001-164223023 CAGGGAAGGGAGCTTGTGCAGGG + Intronic
985391961 4:189499355-189499377 CAGGGAATGCTGCTGGATTCAGG + Intergenic
985663211 5:1167724-1167746 CAGGAAATGCAGCTGGGGATGGG + Intergenic
985669720 5:1201156-1201178 GAGGGAACTCAGCGGGAGCAGGG - Intergenic
985886883 5:2686934-2686956 CAGAGGCTGCCGCTGGAGCAGGG + Intergenic
985892308 5:2725063-2725085 CTGGGAATGCATCTGGGCCAGGG - Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
987574512 5:19707909-19707931 CATGGCATGCAGATGGAGAAGGG - Intronic
988481080 5:31631119-31631141 CAGGGCAGGCAGCCGCAGCATGG + Intergenic
991316460 5:65312892-65312914 TAGGGAAGGTAGCTGGAACAAGG + Intronic
992187677 5:74259881-74259903 TAGGGAATGGAGGTGGAGGAGGG - Intergenic
992397208 5:76379059-76379081 GAGGGCATGTGGCTGGAGCACGG + Intergenic
996121764 5:119680955-119680977 CAGGGGCTGGTGCTGGAGCAGGG - Intergenic
996327515 5:122292157-122292179 CAGGCAATGCACCTGGTGAAGGG - Intergenic
996672863 5:126138808-126138830 CAAGGAATGCAGCTGTGTCATGG - Intergenic
996915508 5:128707532-128707554 CAGGGAAGGGATCTGGAGGAAGG - Intronic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997431500 5:133844138-133844160 CATTGAAAGCAGCTGGATCAGGG - Intergenic
997847851 5:137304372-137304394 GAGGAAAAGCAGCTGGGGCAGGG - Intronic
997980197 5:138464100-138464122 CAGGGACTGCAGGGGGAGCCCGG + Intergenic
998755908 5:145379372-145379394 GAGGCAATGCAGCTGGAATAAGG + Intergenic
999144084 5:149381251-149381273 CAAGCACTGCAGCTGGAGCAGGG - Intronic
999257657 5:150218682-150218704 CCCGGAAGGCAGCTGGTGCAGGG + Intronic
999716383 5:154364213-154364235 CAGAGAATGCACCAGGGGCAGGG + Intronic
999846947 5:155493081-155493103 CAGAGATTGCAGCAGAAGCAAGG + Intergenic
999932820 5:156452154-156452176 GTGGAAATGCAGCTGAAGCACGG - Intronic
1000159036 5:158582066-158582088 CAGGGATTGCAGATGGAGTCTGG + Intergenic
1000261381 5:159591699-159591721 CAGGGAAATCATCTGGACCAAGG - Intergenic
1000773135 5:165382753-165382775 CAGGGAAGCCATCTGGACCAAGG - Intergenic
1001849626 5:174952165-174952187 CAGGGGATGAGGCTGGGGCAGGG - Intergenic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002296418 5:178233513-178233535 CTGGGACTGCAGCAGGTGCAGGG + Intergenic
1002839863 6:896349-896371 CAGGTAAGGCAGCTGGAGACAGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1004191930 6:13471459-13471481 GAGGGAAGGCGGGTGGAGCAGGG + Intronic
1004878376 6:19979255-19979277 CATGGAATGCATTTGGACCAAGG - Intergenic
1005481422 6:26258844-26258866 CAGGGAAAGCAGCTACAGTAGGG + Intergenic
1006093951 6:31644386-31644408 CAGGGAGGGCAGCTGGATGAGGG + Intronic
1007516721 6:42418595-42418617 CAGGTGATGCTGCTGGTGCAGGG + Intronic
1008079831 6:47182239-47182261 AAGGGGATGCACCTAGAGCAGGG + Intergenic
1015912770 6:138185250-138185272 CAGGGAATGAAGCTGACACATGG + Intronic
1016570446 6:145506748-145506770 CAAGGACTGCAGCTGGAGACTGG - Intronic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018388019 6:163322232-163322254 CTGGGCCTGCTGCTGGAGCAGGG - Intergenic
1018391138 6:163342940-163342962 CAGGGAAAGGAGCTAGAGAAAGG - Intergenic
1018573313 6:165233235-165233257 CAGGGGCTGCAGCTGGGGCAGGG + Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019325968 7:438429-438451 CAGTGAAGGCAGGTGGGGCACGG - Intergenic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1020667727 7:11068784-11068806 CAGGGAAAGGGGCTGGGGCAGGG + Intronic
1021256580 7:18399795-18399817 CCAGGAAAGAAGCTGGAGCAGGG + Intronic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1022897805 7:34770537-34770559 CAAGGAAAGCTTCTGGAGCATGG + Intronic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1024890107 7:54190557-54190579 CACGGAATGCATCTGGTGCACGG + Intergenic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1026775335 7:73227522-73227544 CAGGGAATGGAGCAGGGGCTGGG + Intergenic
1027016192 7:74780893-74780915 CAGGGAATGGAGCAGGGGCTGGG + Intronic
1027071836 7:75165044-75165066 CAGGGAATGGAGCAGGGGCTGGG - Intergenic
1028506074 7:91571597-91571619 CAGGGACTGCACCTGAGGCAAGG + Intergenic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1029250608 7:99233507-99233529 CAAGGAAGGCAGGTGGTGCAGGG - Intergenic
1031387950 7:121175904-121175926 CAGGCAAGGCAGCTGGACCAAGG + Intronic
1032191177 7:129766880-129766902 CAGGTCAGGCAGCTGGAGCCCGG - Intergenic
1033227218 7:139571574-139571596 CAGGGAAGCCAGCAGGAGCTAGG - Exonic
1033606650 7:142932638-142932660 CAGGAAGAGCAGCTGGGGCAGGG - Intronic
1034842878 7:154415843-154415865 CAGGGATTTCAGATGAAGCAAGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035120421 7:156562040-156562062 CAGAGAAAGCAGCTGGTTCAGGG + Intergenic
1038124407 8:24655672-24655694 CAGAGATTGCAGGTGGGGCAGGG - Intergenic
1038785018 8:30605460-30605482 AAGGGACTGCAGCTAGAGAAGGG + Intronic
1039915887 8:41860005-41860027 CAGAGAAAGCAACTGGAGCAAGG + Intronic
1041642556 8:60218836-60218858 CAGGGACTGCAACACGAGCAGGG - Intronic
1042676992 8:71332398-71332420 CAGGAAATGCAAGAGGAGCACGG - Intronic
1045005322 8:97912396-97912418 CAGCGAGAGCAGCTGGAGCCGGG + Intronic
1045043277 8:98247771-98247793 CAGGGAAGGCCTCTTGAGCAAGG + Intronic
1047115083 8:121832916-121832938 CAGGGCAGGCAGCTTGAGCTGGG + Intergenic
1047650382 8:126914072-126914094 CAACGAAGGCAGCTGGAGCATGG - Intergenic
1048099163 8:131329046-131329068 CAGATAATGCAGTTGGAACAAGG - Intergenic
1048476925 8:134751933-134751955 CAGGGAATCCACCTGGCTCATGG + Intergenic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1049181720 8:141226389-141226411 CAGGGAAAGCACGTGGGGCAGGG - Intronic
1049235691 8:141511128-141511150 CAGGGAATGATGCTGAAGCAGGG - Intergenic
1049294397 8:141823437-141823459 CAGGGAGTGGAGATGGAGCATGG - Intergenic
1049352413 8:142171311-142171333 CAGGGGCTGCAGCTGCAGGAGGG - Intergenic
1049452943 8:142672119-142672141 GGGGCAATGCAGATGGAGCAAGG - Intronic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1051894580 9:21974648-21974670 GAGGGTCTGCAGCGGGAGCAGGG - Intronic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1054937938 9:70709378-70709400 GAGGGAATGTGGGTGGAGCAAGG - Intronic
1054939629 9:70727371-70727393 GAGGGAATGTGGGTGGAGCAAGG - Intronic
1055589089 9:77791027-77791049 CAGGGAATCCACCTTGATCAAGG + Intronic
1055604119 9:77949993-77950015 GAGGGAATGGAGCTGGAGGAGGG - Intronic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1056562332 9:87742355-87742377 CAAGAAAAGCAGCTGCAGCAAGG + Intergenic
1057076159 9:92139171-92139193 CAGGGAAGGCATATGGAGAAAGG + Intergenic
1057624768 9:96667470-96667492 CAGCCAAGGCAGCTGGAGCTGGG + Intergenic
1057991553 9:99776008-99776030 CAGGGTATTCTCCTGGAGCAGGG - Intergenic
1058880677 9:109283453-109283475 CAGGATATGCAACTGGAGAAAGG + Intronic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059088766 9:111334140-111334162 CAGGGAGGGGAGCCGGAGCAGGG + Intergenic
1059435500 9:114273580-114273602 GAGGGCATGAAGCTGGAGCCTGG - Intronic
1060528473 9:124333738-124333760 CAGGCAATTCAGCTGCAGCATGG + Intronic
1061661968 9:132136338-132136360 CAGGGTGTGCTGCCGGAGCAGGG - Intergenic
1061816341 9:133199699-133199721 CTGGGAACGCAGCTGCAGCTGGG - Intergenic
1062428058 9:136515136-136515158 CAGAGATTGCAGCGGGACCAGGG - Intronic
1062453989 9:136627185-136627207 CAGGAAGCCCAGCTGGAGCACGG + Intergenic
1062698676 9:137888165-137888187 CAGGGAGTGGCGCTGGAGAACGG + Intronic
1203785142 EBV:123435-123457 CTTGGAATGCAGCTGGGGCCAGG + Intergenic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1186685871 X:11923461-11923483 GAGGCAATGCAGCTGGGGTAGGG - Intergenic
1186785822 X:12955206-12955228 CAGAGGACCCAGCTGGAGCAGGG + Intergenic
1186932623 X:14411541-14411563 CAGGAAATGCAGCTGGTGAGGGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1192165391 X:68824539-68824561 CCAGGCATGCAGCTGGGGCAGGG + Intergenic
1199073904 X:143509246-143509268 GAAGGAATGCAGGTGGAGGAAGG + Intronic
1199215422 X:145255565-145255587 GAAGGAATGCAGGTGGAGGAAGG - Intronic
1200125231 X:153810340-153810362 CGGGGAAGGCTTCTGGAGCAGGG + Intronic
1200256789 X:154586573-154586595 CAGGGAAAGCTGCTGGAGACAGG - Exonic
1200260980 X:154617830-154617852 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1200267022 X:154652198-154652220 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1201150698 Y:11094151-11094173 CAGGGGATGTACCTGGAGCCTGG - Intergenic