ID: 997340491

View in Genome Browser
Species Human (GRCh38)
Location 5:133140948-133140970
Sequence GGGCTTCTCACTGGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997340485_997340491 -8 Left 997340485 5:133140933-133140955 CCCAGGACCTGGGAGGGGCTTCT No data
Right 997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG No data
997340472_997340491 26 Left 997340472 5:133140899-133140921 CCTCTTGATTTACCCATCTCTGA No data
Right 997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG No data
997340478_997340491 13 Left 997340478 5:133140912-133140934 CCATCTCTGAGGCAGGGGACTCC No data
Right 997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG No data
997340486_997340491 -9 Left 997340486 5:133140934-133140956 CCAGGACCTGGGAGGGGCTTCTC No data
Right 997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG No data
997340477_997340491 14 Left 997340477 5:133140911-133140933 CCCATCTCTGAGGCAGGGGACTC No data
Right 997340491 5:133140948-133140970 GGGCTTCTCACTGGGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997340491 Original CRISPR GGGCTTCTCACTGGGAAGGC AGG Intergenic
No off target data available for this crispr