ID: 997344747

View in Genome Browser
Species Human (GRCh38)
Location 5:133180531-133180553
Sequence GTTGTTGTAATAGCAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997344747_997344749 11 Left 997344747 5:133180531-133180553 CCAGCCTTTGCTATTACAACAAC No data
Right 997344749 5:133180565-133180587 CTATTCATGAACATGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997344747 Original CRISPR GTTGTTGTAATAGCAAAGGC TGG (reversed) Intergenic
No off target data available for this crispr