ID: 997345592

View in Genome Browser
Species Human (GRCh38)
Location 5:133189723-133189745
Sequence CAGTGGCCTCACAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997345592_997345599 1 Left 997345592 5:133189723-133189745 CCCATTTCCCTGTGAGGCCACTG No data
Right 997345599 5:133189747-133189769 AAGGAAAGCCCAAGTGTGTGTGG No data
997345592_997345603 20 Left 997345592 5:133189723-133189745 CCCATTTCCCTGTGAGGCCACTG No data
Right 997345603 5:133189766-133189788 GTGGAGAGACAAGCGCTGTTGGG No data
997345592_997345602 19 Left 997345592 5:133189723-133189745 CCCATTTCCCTGTGAGGCCACTG No data
Right 997345602 5:133189765-133189787 TGTGGAGAGACAAGCGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997345592 Original CRISPR CAGTGGCCTCACAGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr