ID: 997346009

View in Genome Browser
Species Human (GRCh38)
Location 5:133192697-133192719
Sequence GACTGGCCTCCCCTTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346006_997346009 -9 Left 997346006 5:133192683-133192705 CCATAATAGAAAAAGACTGGCCT No data
Right 997346009 5:133192697-133192719 GACTGGCCTCCCCTTAAGGAGGG No data
997346004_997346009 10 Left 997346004 5:133192664-133192686 CCATTCAATCAGTTGAAGGCCAT No data
Right 997346009 5:133192697-133192719 GACTGGCCTCCCCTTAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346009 Original CRISPR GACTGGCCTCCCCTTAAGGA GGG Intergenic
No off target data available for this crispr