ID: 997346039

View in Genome Browser
Species Human (GRCh38)
Location 5:133192886-133192908
Sequence CAGTATTAGGCAGGGCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346039_997346043 10 Left 997346039 5:133192886-133192908 CCTAGGGGCCCTGCCTAATACTG No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data
997346039_997346045 14 Left 997346039 5:133192886-133192908 CCTAGGGGCCCTGCCTAATACTG No data
Right 997346045 5:133192923-133192945 TCTTTAAGCTCACTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346039 Original CRISPR CAGTATTAGGCAGGGCCCCT AGG (reversed) Intergenic
No off target data available for this crispr