ID: 997346040

View in Genome Browser
Species Human (GRCh38)
Location 5:133192894-133192916
Sequence TGCTATGACAGTATTAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346040_997346043 2 Left 997346040 5:133192894-133192916 CCCTGCCTAATACTGTCATAGCA No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data
997346040_997346045 6 Left 997346040 5:133192894-133192916 CCCTGCCTAATACTGTCATAGCA No data
Right 997346045 5:133192923-133192945 TCTTTAAGCTCACTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346040 Original CRISPR TGCTATGACAGTATTAGGCA GGG (reversed) Intergenic