ID: 997346043

View in Genome Browser
Species Human (GRCh38)
Location 5:133192919-133192941
Sequence GCCGTCTTTAAGCTCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346038_997346043 11 Left 997346038 5:133192885-133192907 CCCTAGGGGCCCTGCCTAATACT No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data
997346041_997346043 1 Left 997346041 5:133192895-133192917 CCTGCCTAATACTGTCATAGCAT No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data
997346042_997346043 -3 Left 997346042 5:133192899-133192921 CCTAATACTGTCATAGCATAGCC No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data
997346040_997346043 2 Left 997346040 5:133192894-133192916 CCCTGCCTAATACTGTCATAGCA No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data
997346039_997346043 10 Left 997346039 5:133192886-133192908 CCTAGGGGCCCTGCCTAATACTG No data
Right 997346043 5:133192919-133192941 GCCGTCTTTAAGCTCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346043 Original CRISPR GCCGTCTTTAAGCTCACTGA AGG Intergenic
No off target data available for this crispr