ID: 997346536

View in Genome Browser
Species Human (GRCh38)
Location 5:133196315-133196337
Sequence CCGGGTCCAAAAGCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346536_997346544 20 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346544 5:133196358-133196380 CCCACTGGAGCAGAAGAATGAGG 0: 1
1: 0
2: 1
3: 19
4: 265
997346536_997346546 21 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346546 5:133196359-133196381 CCACTGGAGCAGAAGAATGAGGG 0: 1
1: 1
2: 1
3: 24
4: 243
997346536_997346542 5 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143
997346536_997346538 -8 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346536 Original CRISPR CCGGGTCCAAAAGCCCACCC AGG (reversed) Intergenic