ID: 997346536

View in Genome Browser
Species Human (GRCh38)
Location 5:133196315-133196337
Sequence CCGGGTCCAAAAGCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346536_997346546 21 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346546 5:133196359-133196381 CCACTGGAGCAGAAGAATGAGGG 0: 1
1: 1
2: 1
3: 24
4: 243
997346536_997346544 20 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346544 5:133196358-133196380 CCCACTGGAGCAGAAGAATGAGG 0: 1
1: 0
2: 1
3: 19
4: 265
997346536_997346538 -8 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346536_997346542 5 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346536 Original CRISPR CCGGGTCCAAAAGCCCACCC AGG (reversed) Intergenic
900344800 1:2205450-2205472 CCAGGTCCACAGGCCCAGCCCGG + Intronic
900603653 1:3514496-3514518 CAGGGTCAGAAAGCGCACCCAGG - Intronic
900981280 1:6047630-6047652 CAGGCTCCAAAAGGCCAACCAGG - Intronic
900981631 1:6049205-6049227 CAGGCTCCAAAAGGCCAACCAGG - Intronic
901644162 1:10707651-10707673 CAGGGTCCCAGATCCCACCCAGG - Intronic
901845606 1:11980337-11980359 CAGGGTCCACCAGCTCACCCGGG + Exonic
902983639 1:20142448-20142470 CTGGGTCCACACGCCCAGCCTGG - Intronic
903327917 1:22581969-22581991 CCAGGTCCAAGAGCCCTGCCTGG + Intronic
906069701 1:43007769-43007791 CCGACCCCAAAAGCCCACGCAGG - Intergenic
906626340 1:47329021-47329043 CAGGGTCCAAAAGCCCTCTGTGG - Intergenic
915230964 1:154445066-154445088 CTGGGTCCCAAATGCCACCCGGG - Intronic
917837680 1:178953904-178953926 CCAAGGCCAAAAGCTCACCCAGG + Intergenic
1063133144 10:3195501-3195523 CCTGGCTCCAAAGCCCACCCTGG - Intergenic
1063974854 10:11406937-11406959 CCTGGTGCAAAAGCCCTCCCAGG + Intergenic
1067061965 10:43082214-43082236 CAGGGGCCAAGAGCCCAGCCAGG - Intronic
1067660410 10:48233078-48233100 CCATGTCCCAAAGCCCAGCCTGG + Intronic
1076826866 10:132973649-132973671 CCGGCACCCAGAGCCCACCCCGG - Intergenic
1076985915 11:236139-236161 CCGGGTCCAAGGGCTCACCGCGG + Exonic
1078057469 11:8019463-8019485 CCGGGTGCCCAAGCCCACCCTGG - Intronic
1081970403 11:47194413-47194435 CCTGCTCCAGAAGCCTACCCTGG + Intergenic
1088522402 11:110713017-110713039 CCGGCTGCAGAAGCCCACTCAGG - Intronic
1091343344 11:134836909-134836931 CTGGGTTCAACAGCCCACCCTGG - Intergenic
1092997902 12:13967726-13967748 CCTGCTCCCATAGCCCACCCTGG - Intronic
1095950694 12:47780305-47780327 CCAGGTCCTAAGGCCCCCCCAGG - Exonic
1103850568 12:123930316-123930338 CCGGGGCCAGAGGCTCACCCAGG - Exonic
1104062671 12:125281441-125281463 CAGGCTTCGAAAGCCCACCCCGG + Intronic
1108525088 13:51279664-51279686 CCTGGTCCAGCAGCCCTCCCTGG - Intronic
1111325494 13:86690494-86690516 CTGGGTCCAAAAGAACACCAAGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1119472566 14:74909062-74909084 CCAGGTGCTAAGGCCCACCCTGG + Intronic
1120907659 14:89634249-89634271 CTGGGTCCAAAGGCCAACCTTGG + Intronic
1121444921 14:93972778-93972800 CCATGGCCAAAGGCCCACCCTGG - Intronic
1122320789 14:100854579-100854601 CGGAGTCCACAAGCACACCCAGG - Intergenic
1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG + Intergenic
1133264607 16:4575679-4575701 CAGAGGCCAAGAGCCCACCCTGG - Exonic
1134254474 16:12600356-12600378 CCGGGTCCAGAACCACAGCCGGG - Intergenic
1136497481 16:30653037-30653059 CCGGGCCCCCCAGCCCACCCTGG + Exonic
1139505103 16:67394699-67394721 CCGGGGCCGACAGCCCACGCTGG - Exonic
1141677988 16:85527621-85527643 CCGGGACCAGCAGCCTACCCCGG + Intergenic
1142375265 16:89703323-89703345 GCAGGTGCAAAAACCCACCCAGG - Intergenic
1143362567 17:6383788-6383810 CCAGGTCCAAAGGCAAACCCCGG - Intergenic
1149263100 17:54900505-54900527 ACGGGGCGAAAAGCCCACCTGGG + Exonic
1149342468 17:55700931-55700953 CAGAGTCCCAAAGTCCACCCTGG + Intergenic
1150349174 17:64429440-64429462 CCGAGACCAAAAGCTCTCCCAGG + Intergenic
1152649312 17:81484571-81484593 AGGGGTCCCAAGGCCCACCCAGG - Intergenic
1157578334 18:48758649-48758671 CTGGTTCCAAGTGCCCACCCTGG - Intronic
1159506937 18:69350829-69350851 CTGGGCCCTAAATCCCACCCTGG + Intergenic
1160874688 19:1291525-1291547 CCGGGTCCTGAAGCCCAGCGTGG - Intronic
1163953510 19:20612984-20613006 CCGAGGCCAACAGCCCCCCCAGG + Intronic
1165362690 19:35346455-35346477 GGGGGTCCAAAAGCCCAGGCGGG - Intronic
1166348682 19:42183082-42183104 CCGGGTTCAGAAGCTCTCCCAGG + Intronic
929913484 2:46114089-46114111 TCGGGTCCAAAGGCCCAGCCTGG - Intronic
935170401 2:100607181-100607203 CCAGGTCCAGAAGCTCAGCCAGG - Intergenic
937808712 2:126175590-126175612 CCCGGTCCAACAGCTCACCATGG + Intergenic
938067222 2:128287684-128287706 CCCTGTCCAAAAGCCCAGCATGG + Intronic
940781540 2:157938665-157938687 CCTGGGACAAATGCCCACCCTGG - Intronic
946702086 2:222424430-222424452 CCGGGTCCTAGCGCCCGCCCAGG - Intergenic
1172167500 20:32907974-32907996 CTGGGTACAAAAGCCAAGCCAGG - Intronic
1172186064 20:33031743-33031765 CCGGGCCCACAAGCTCACCACGG - Exonic
1172481109 20:35271852-35271874 CCGGCTCCCCATGCCCACCCTGG - Intronic
1174570205 20:51496037-51496059 CAGGTTCCAAACCCCCACCCAGG + Intronic
1176042732 20:63073769-63073791 CAGGGTGCACAAGGCCACCCAGG - Intergenic
1176946348 21:14987100-14987122 CCGTCTCCAAAAGACCACCTTGG - Intronic
1179341584 21:40515709-40515731 CCGGGTGCACAAGCCCTCCCAGG + Intronic
1179982890 21:44905708-44905730 CAGGGGACAAAACCCCACCCTGG - Intronic
1180695436 22:17748865-17748887 CAGTGTCCAAAAGACCACTCTGG - Intronic
1181809514 22:25394941-25394963 CCCTGTCCTCAAGCCCACCCAGG + Intronic
1182459938 22:30476420-30476442 CCGGGACCACCAGCCCAACCAGG + Intergenic
1183032730 22:35117696-35117718 CAGGGTCTGACAGCCCACCCGGG - Intergenic
1183032743 22:35117755-35117777 CAGGGTCTGACAGCCCACCCGGG - Intergenic
1183032894 22:35118731-35118753 CAGGGTCTGACAGCCCACCCGGG + Intergenic
1185317811 22:50186329-50186351 CCGGCTCCAAAACCTGACCCGGG - Intronic
951379260 3:21963067-21963089 CCTGGTTCAAAAACCCAACCTGG + Intronic
954082985 3:48223432-48223454 CCTGATGCAAAAGCCCAACCAGG - Exonic
954134041 3:48573862-48573884 CAGGGTCCAAGAGGCCCCCCTGG - Exonic
955164073 3:56493517-56493539 CCGGGTCAAAAAGAATACCCAGG + Intergenic
960763524 3:121098752-121098774 CCAGGTTCAAAAGACCACTCTGG + Intronic
961812730 3:129531154-129531176 CCTGGCCCAAATGCCCACTCAGG + Intronic
967129238 3:186455325-186455347 TCGGGTTCAAAAGCCCGACCTGG + Intergenic
967135597 3:186510268-186510290 CTGGCTCCAAAATCCCACCATGG + Intergenic
967888959 3:194351486-194351508 CCGGGGCCAAAATCCCACCGAGG + Intergenic
968551435 4:1225680-1225702 CCGTGTCCCCAAGGCCACCCCGG + Intronic
968794910 4:2696941-2696963 CAGGCCCCAAAAGCCCACCTGGG - Intronic
983534344 4:168841197-168841219 CCAGGTCCAACAGCTCACCTTGG - Intronic
984892885 4:184509114-184509136 GCAGGCACAAAAGCCCACCCAGG - Intergenic
985885708 5:2676141-2676163 GAGGGTCCCAGAGCCCACCCTGG + Intergenic
986262927 5:6164501-6164523 CTGGGTTCAGAAGCCCACCTGGG + Intergenic
988925908 5:35991022-35991044 CCAGGTCCGCAAGCCCAGCCTGG + Intronic
988934231 5:36066571-36066593 CCGGGTCCGCAAGCCCAGCCTGG + Intronic
997346536 5:133196315-133196337 CCGGGTCCAAAAGCCCACCCAGG - Intergenic
997693521 5:135843915-135843937 CTGGGTCCCAGAGCCCACCAAGG + Intronic
1001928762 5:175658203-175658225 CCGGGTCCCCAAGCCCGCCTGGG - Intronic
1002986100 6:2191470-2191492 CCGGGTCCACAGCCCCACCTGGG - Intronic
1003530191 6:6930617-6930639 CCTGGTCACAAAGCCCACCTTGG + Intergenic
1011197683 6:84799080-84799102 CCCTGTCCAAAAGCATACCCAGG + Intergenic
1013980133 6:116120611-116120633 CCAGGTCCAAGAGGCCACTCTGG - Exonic
1016415513 6:143828875-143828897 CCAGGTTCAAATGCCCTCCCTGG + Intronic
1019304686 7:327632-327654 CCGTTGCCACAAGCCCACCCTGG - Intergenic
1021776430 7:24059439-24059461 GGTGGTCCAACAGCCCACCCGGG + Intergenic
1026592760 7:71711053-71711075 TTGGGTCCACAAGCCCAGCCCGG - Intronic
1029123310 7:98282055-98282077 CCGGGTCCCGAAGCCAGCCCGGG - Intronic
1029146088 7:98447187-98447209 CCTGCTCCAAAAGACCAGCCTGG - Intergenic
1037298792 8:17430104-17430126 TTGGTTCCAAATGCCCACCCAGG + Intergenic
1039581552 8:38671002-38671024 AGGGGTCCAAAATCCCAGCCTGG + Intergenic
1041287982 8:56280442-56280464 CTGGATCCACAAGTCCACCCAGG - Intergenic
1048688401 8:136930385-136930407 CCAGGACCAATAACCCACCCAGG + Intergenic
1048855873 8:138686237-138686259 CCAGGTCCTCAAGCCGACCCCGG - Intronic
1049039168 8:140099427-140099449 CAGGGTACTGAAGCCCACCCGGG + Intronic
1049189055 8:141276505-141276527 GCAGGTCCATAACCCCACCCAGG + Intronic
1055305056 9:74920876-74920898 CCGGGTCCAAAAGATTATCCAGG + Intergenic
1061432049 9:130537244-130537266 CCTGTTCCAACAGCCCAGCCTGG + Intergenic
1061512277 9:131068507-131068529 CTGTGGCCAAAAGGCCACCCAGG - Intronic
1061994264 9:134175873-134175895 CTGGGTCCTTCAGCCCACCCTGG - Intergenic
1062386429 9:136313450-136313472 CTGTCTCCAAAAGCCCACCCAGG - Intergenic
1185488385 X:500127-500149 CCGGTCCCCAAAGCCCTCCCCGG + Intergenic
1190775125 X:53546503-53546525 CCGGGTCCCAGAGTCCCCCCGGG + Exonic
1192199455 X:69056471-69056493 CCTGTTCCAAAATCCCATCCAGG + Intergenic
1196151609 X:112380856-112380878 CAGGGGACAAAAGCCCTCCCAGG - Intergenic
1199001015 X:142636280-142636302 CAGAGTCCAAAAACCCAGCCAGG + Intergenic
1200117141 X:153774357-153774379 CCCGGTCCACCTGCCCACCCAGG - Intronic