ID: 997346538

View in Genome Browser
Species Human (GRCh38)
Location 5:133196330-133196352
Sequence GGACCCGGAGCCTTTATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346536_997346538 -8 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346530_997346538 9 Left 997346530 5:133196298-133196320 CCATCCGTCTGGGGCTGCCTGGG 0: 1
1: 0
2: 3
3: 33
4: 327
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346528_997346538 13 Left 997346528 5:133196294-133196316 CCTGCCATCCGTCTGGGGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346527_997346538 17 Left 997346527 5:133196290-133196312 CCTTCCTGCCATCCGTCTGGGGC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346525_997346538 18 Left 997346525 5:133196289-133196311 CCCTTCCTGCCATCCGTCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 198
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346533_997346538 5 Left 997346533 5:133196302-133196324 CCGTCTGGGGCTGCCTGGGTGGG 0: 1
1: 0
2: 5
3: 41
4: 394
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346523_997346538 19 Left 997346523 5:133196288-133196310 CCCCTTCCTGCCATCCGTCTGGG 0: 1
1: 0
2: 0
3: 30
4: 238
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
997346521_997346538 20 Left 997346521 5:133196287-133196309 CCCCCTTCCTGCCATCCGTCTGG 0: 1
1: 0
2: 1
3: 27
4: 303
Right 997346538 5:133196330-133196352 GGACCCGGAGCCTTTATGCAAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346538 Original CRISPR GGACCCGGAGCCTTTATGCA AGG Intergenic