ID: 997346542

View in Genome Browser
Species Human (GRCh38)
Location 5:133196343-133196365
Sequence TTATGCAAGGTTCTGCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997346536_997346542 5 Left 997346536 5:133196315-133196337 CCTGGGTGGGCTTTTGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143
997346527_997346542 30 Left 997346527 5:133196290-133196312 CCTTCCTGCCATCCGTCTGGGGC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143
997346533_997346542 18 Left 997346533 5:133196302-133196324 CCGTCTGGGGCTGCCTGGGTGGG 0: 1
1: 0
2: 5
3: 41
4: 394
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143
997346530_997346542 22 Left 997346530 5:133196298-133196320 CCATCCGTCTGGGGCTGCCTGGG 0: 1
1: 0
2: 3
3: 33
4: 327
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143
997346528_997346542 26 Left 997346528 5:133196294-133196316 CCTGCCATCCGTCTGGGGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 997346542 5:133196343-133196365 TTATGCAAGGTTCTGCCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997346542 Original CRISPR TTATGCAAGGTTCTGCCCAC TGG Intergenic